Vector: pLKO-scramble

Number of plasmids with this backbone: 1
Name: pLKO-scramble
Description: Control hairpin designed to demonstrate positive infection via conferred puromycin resistance, but will not target a protein in human genome.
Synonyms: SCR, scramble, scrambled shRNA
Type: bacterial plasmid
Form: dsDNA
Size (bp):: 7095
Properties: viral production
Vector Map: pLKO.1-puro.jpg
Vector Sequence: pLKO-scramble.txt
Comments:

Features:

Type Name Description Start Position End Position
primer site hU6 1 19
hairpin scrambled shRNA CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG 153 200
polypurine tract cppt 251 266
mammalian antibiotic puroR 945 1544
polypurine tract cPPT #2 1655 1670
viral LTR 3' LTR 1725 1905
primer site T7 2293 2313
primer site M13 forward 2322 2339
bacterial selection antibiotic AmpR 3264 3923
primer site M13 reverse 5071 5091
primer site T3 5109 5128
viral LTR 5' 5381 5561
viral packaging component psi 5672 5716
viral response element RRE 6226 6459

Authors:

Author Name Author Type Creation Date
TRC Academic researcher, vector creator

Publications:

PMID Title

Parent Vector:

Name Comments