Vector: pJP1520
Number of plasmids with this backbone: | 1 |
Name: | pJP1520 |
Description: | Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning. |
Synonyms: | |
Type: | bacterial plasmid |
Form: | dsDNA |
Size (bp):: | 7894 |
Properties: | Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector |
Vector Map: | pJP1520.pdf |
Vector Sequence: | pJP1520.txt |
Comments: | One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP |
Type | Name | Description | Start Position | End Position |
bacterial origin | ori | bacterial origin of replication | 0 | 0 |
viral LTR | 5p LTR | 5p viral LTR (MPSV U3, R, U5) | 550 | 1139 |
primer site | PBSQ | primer binding sequence (glutamine tRNA primer binding site) | 1140 | 1156 |
gene fragment | gag/pol/env | non-functional gag/pol/env for packaging efficiency | 1871 | 2644 |
recombination site | LoxP | LoxP site for recombinational cloning | 3651 | 3684 |
promoter | bact pr | bacterial promoter (for chlR ORF in Creator-type inserts) | 3879 | 4005 |
viral LTR | 3p LTR | 3p viral LTR (MPSV U3, R, U5) | 3962 | 4551 |
selectable marker | ampR | ampicillin resistance gene (beta-lactamase) | 6237 | 7094 |
primer | JPO113 | forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG | 0 | 0 |
Authors:
Author Name | Author Type | Creation Date |
Ed Harlow | Academic researcher, vector PI | |
Joseph Pearlberg | Academic researcher, vector donor and author |
Publications:
PMID | Title |
Parent Vector:
Name | Comments |