Vector: pJP1520

Number of plasmids with this backbone: 1
Name: pJP1520
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Synonyms:
Type: bacterial plasmid
Form: dsDNA
Size (bp):: 7894
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Vector Map: pJP1520.pdf
Vector Sequence: pJP1520.txt
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP

Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 0 0
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
recombination site LoxP LoxP site for recombinational cloning 3651 3684
promoter bact pr bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551
selectable marker ampR ampicillin resistance gene (beta-lactamase) 6237 7094
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 0 0

Authors:

Author Name Author Type Creation Date
Ed Harlow Academic researcher, vector PI
Joseph Pearlberg Academic researcher, vector donor and author

Publications:

PMID Title

Parent Vector:

Name Comments