Clone: ScCD00098007

Clone ID:ScCD00098007
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 261331
HIP Master Clone ID 6086
Original Clone ID FLH261331.01X

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1527 Saccharomyces cerevisiae CLOSED Genomic DNA template YOR231W MKK1 Mitogen-activated kinase kinase involved in protein kinase C signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p
Insert1
Size (bp)1527
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YOR231W
Gene SymbolMKK1
Gene NameMitogen-activated kinase kinase involved in protein kinase C signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p
Keyword

Insert Sequence:

ATGGCTTCACTGTTCAGACCCCCAGAATCTGCGAAATGCAACCCAAACTCTCCTAGACTTAAACTGCCCCTCTTACGAAATAATCAGGTAGATGAAAATAATATATACTTGACGTCGAATGGGAGTTCCACCACAGCTTACAGTAGCCACACCCCAGAACCACTGACCTCTTCCACATCGACACTTTTCTCCCAAACTCGACTTCATCCTAGCGACTCTTCAATGACTTTAAATACAATGAAGAAGAGGCCTGCACCGCCATCTTTACCTTCGCTCAGCATAAATTCACAGTCTAAGTGCAAAACACTACCCGAACTCGTACCCATCGCCGATGTGTCTGATGGTAAACATGATTTAGGATTGAAACAGCGTGTGATAGCCGAAAATGAGTTGTCTGGTAATAGTGACTTAACCCCTTCATCGATGGCAAGCCCCTTTTCACATACAAACACCTCTTCTCCCTACCTCAGAAATGATCTGAGCAATTCAGTGGGATCTGACTTTTCAAATTTGATATCGGCATATGAACAAAGTTCAAGTCCCATCAAGTCATCGTCCCAGCCTAAATCATCTTCTGAATCGTACATAGACTTAAACAGTGTACGAGATGTTGATCAATTGGATGAAAATGGTTGGAAATATGCAAATTTAAAAGATAGGATCGAGACATTAGGCATTCTAGGAGAAGGAGCCGGTGGCTCTGTTTCCAAGTGTAAATTGAAAAATGGATCAAAAATATTCGCTTTAAAAGTGATAAACACATTAAATACAGATCCCGAGTATCAGAAGCAAATATTCAGAGAATTACAGTTTAATAGGAGTTTCCAATCCGAATATATCGTACGATATTATGGAATGTTTACGGATGACGAAAACTCTTCAATTTATATTGCTATGGAGTACATGGGTGGGCGATCGTTGGATGCTATTTATAAAAATTTGTTAGAGCGTGGTGGTAGGATCAGTGAAAAAGTCCTGGGGAAGATTGCAGAAGCGGTACTAAGAGGACTATCATATTTGCATGAAAAAAAAGTTATTCATAGAGATATTAAGCCCCAGAATATTTTACTGAATGAAAATGGTCAGGTGAAACTTTGTGATTTTGGGGTCAGTGGAGAAGCCGTTAACTCGCTAGCCACAACATTCACGGGGACGTCATTCTATATGGCTCCAGAAAGGATTCAAGGTCAACCATACAGTGTCACATCTGATGTATGGTCACTTGGATTAACGATTTTGGAAGTGGCGAACGGGAAATTTCCATGCTCTTCCGAGAAGATGGCAGCCAATATAGCTCCCTTTGAATTGTTAATGTGGATTTTAACATTTACTCCTGAATTAAAGGATGAACCCGAATCTAATATCATATGGAGTCCATCATTCAAATCCTTTATCGACTACTGTCTGAAAAAAGATAGTCGTGAACGGCCATCTCCAAGACAAATGATCAATCATCCTTGGATAAAGGGTCAAATGAAAAAAAATGTCAATATGGAAAAATTCGTGAGGAAGTGCTGGAAAGATTAA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1527
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TTTTGATTGATTGTACAGGAAAATATACATCGCAGGGGGTTGACTTTTACCATTTCACCGCAATGGAATCAAACTTGTTGAAGAGAATGTTCACAGGCGCATACGCTACAATGACCCGATTCTTGCTAGCCTTTTCTCGGTCTTGCAAACAACCGCCGGCAGCTTAGTATATAAATACACATGTACATACCTCTCTCCGTATCCTCGTAATCATTTTCTTGTATTTATCGTCTTTTCGCTGTAAAAACTTTATCACACTTATCTCAAATACACTTATTAACCGCTTTTACTATTATCTTCTACGCTGACAGTAATATCAAACAGTGACACATATTAAACACAGTGGTTTCTTTGCATAAACACCATCAGCCTCAAGTCGTCAAGTAAAGATTTCTTGTTCATGCAGATAGATAACAATCTATATGTTGATAATTAGCGTTGCCTCATCAATGCGAGATCCGTTTAACCGGACCCTAGTGCACTTACCCCACGTTCGGTCCACTGTGTGCCGAACATGCTCCTTCACTATTTTAACATGTGGAATTAATTCTCATGTTTGACAGCTTATCATCGAACTCTAAGAGGTGATACTTATTTACTGTAAAACTGTGACGATAAAACCGGAAGGAAGAATAAGAAAACTCGAACTGATCTATAATGCCTATTTTCTGTAAAGAGTTTAAGCTATGAAAGCCTCGGCATTTTGGCCGCTCCTAGGTAGTGCTTTTTTTCCAAGGACAAAACAGTATCTTTTTCTTGAGCAGGTTTTATGTTTCGGTAATCATAAACAATAAATAAATTAATTCATTTATGTTTAAAAATAAAAAGAGCCTCGGCATTTGGCCGCTCCTAGGTAGGCTTTTTTCCAGGGCCAAACAGTTTTTTTTTCTGAGCAGGTTTATGTTCGGTAATCATAAACAATAAATAAATTATTCATTTTTTTTAAAAATAAAAAATAAAAAAGTATTTTAAATTTTTAAAAAAGTTGATTATAAGCATGTGACCTTTTGCAAGCAATTAAATTTTGCAATTTGTGATTTAGGCAAAAGTTACTATTTCTGGCTCGTGTAATATATGTATGCTAATGTGAACTTTTACAAAGTCGATATGGACTTAGTCAAAAGAAATTTTCTTAAAAATATATAGCACTAGCCAATTTAGCACTTCTTTATGAGATATATTATAGACTTTATTAAGCCAGATTTGTGTATTATATGTATTTACCCGGCGAATCATGGACATACATTCTGAAATAGGTAATATTCTCTATGGTGAGACAGCATAGATAACCTAGGATACAAGTTAAAAGCTAGTACTGTTTTGCAGTAATTTTTTTCTTTTTTATAAGAATGTTACCACCTAAATAAGTTATAAAGTCAATAGTTAAGTTTGATATTTGATTGTAAAATACCGTAATATATTTGCATGATCAAAAGGCTCAATGTTGACTAGCCAGCATGTCAACCACTATATTGATCACCGATATTAGGACTTCCACACCAACTAGTAATATGACAATAAATTCAAGATATTCTTCATGAGAATGGCCCAGCGATTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACATCGAATTAATTCCTTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCTCTAGAGTCGACCATCACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGCTTCACTGTTCAGACCCCCAGAATCTGCGAAATGCAACCCAAACTCTCCTAGACTTAAACTGCCCCTCTTACGAAATAATCAGGTAGATGAAAATAATATATACTTGACGTCGAATGGGAGTTCCACCACAGCTTACAGTAGCCACACCCCAGAACCACTGACCTCTTCCACATCGACACTTTTCTCCCAAACTCGACTTCATCCTAGCGACTCTTCAATGACTTTAAATACAATGAAGAAGAGGCCTGCACCGCCATCTTTACCTTCGCTCAGCATAAATTCACAGTCTAAGTGCAAAACACTACCCGAACTCGTACCCATCGCCGATGTGTCTGATGGTAAACATGATTTAGGATTGAAACAGCGTGTGATAGCCGAAAATGAGTTGTCTGGTAATAGTGACTTAACCCCTTCATCGATGGCAAGCCCCTTTTCACATACAAACACCTCTTCTCCCTACCTCAGAAATGATCTGAGCAATTCAGTGGGATCTGACTTTTCAAATTTGATATCGGCATATGAACAAAGTTCAAGTCCCATCAAGTCATCGTCCCAGCCTAAATCATCTTCTGAATCGTACATAGACTTAAACAGTGTACGAGATGTTGATCAATTGGATGAAAATGGTTGGAAATATGCAAATTTAAAAGATAGGATCGAGACATTAGGCATTCTAGGAGAAGGAGCCGGTGGCTCTGTTTCCAAGTGTAAATTGAAAAATGGATCAAAAATATTCGCTTTAAAAGTGATAAACACATTAAATACAGATCCCGAGTATCAGAAGCAAATATTCAGAGAATTACAGTTTAATAGGAGTTTCCAATCCGAATATATCGTACGATATTATGGAATGTTTACGGATGACGAAAACTCTTCAATTTATATTGCTATGGAGTACATGGGTGGGCGATCGTTGGATGCTATTTATAAAAATTTGTTAGAGCGTGGTGGTAGGATCAGTGAAAAAGTCCTGGGGAAGATTGCAGAAGCGGTACTAAGAGGACTATCATATTTGCATGAAAAAAAAGTTATTCATAGAGATATTAAGCCCCAGAATATTTTACTGAATGAAAATGGTCAGGTGAAACTTTGTGATTTTGGGGTCAGTGGAGAAGCCGTTAACTCGCTAGCCACAACATTCACGGGGACGTCATTCTATATGGCTCCAGAAAGGATTCAAGGTCAACCATACAGTGTCACATCTGATGTATGGTCACTTGGATTAACGATTTTGGAAGTGGCGAACGGGAAATTTCCATGCTCTTCCGAGAAGATGGCAGCCAATATAGCTCCCTTTGAATTGTTAATGTGGATTTTAACATTTACTCCTGAATTAAAGGATGAACCCGAATCTAATATCATATGGAGTCCATCATTCAAATCCTTTATCGACTACTGTCTGAAAAAAGATAGTCGTGAACGGCCATCTCCAAGACAAATGATCAATCATCCTTGGATAAAGGGTCAAATGAAAAAAAATGTCAATATGGAAAAATTCGTGAGGAAGTGCTGGAAAGATTAAGACCCAGCTTTCTTGTACAAAGTGGTGATGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGGGGGGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAGCTTTTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCCTTGAAATTTTTTTGATTCGGTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACATGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCAATTCTCATGTTTGACAGCTTATCATCGATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAGAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAAGGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCTGCAAGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGCT

Vector Information:

Vector Name:pBY011
Type:bacterial plasmid
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Properties:Gateway, acceptor (destination), inducible expression, yeast expression, yeast shuttle
Comments:This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Map:pBY011_map.pdf
Sequence:pBY011.txt
Size (bp):7920
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast uracil

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.