Clone: ScCD00095502

Clone ID:ScCD00095502
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 261460
HIP Master Clone ID 175760
Original Clone ID FLH261460.01X

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1374 Saccharomyces cerevisiae CLOSED Genomic DNA template YAL062W GDH3 Involved in glutamate biosynthesis
Insert1
Size (bp)1374
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YAL062W
Gene SymbolGDH3
Gene NameInvolved in glutamate biosynthesis
Keyword

Insert Sequence:

ATGACAAGCGAACCAGAATTTCAGCAGGCTTACGATGAGATCGTTTCTTCTGTGGAGGATTCCAAAATTTTTGAAAAATTCCCACAGTATAAAAAAGTGTTACCTATTGTTTCTGTCCCGGAGAGGATCATTCAATTCAGGGTCACGTGGGAAAATGATAATGGCGAGCAAGAAGTGGCTCAAGGATACAGGGTGCAGTTCAATTCAGCCAAGGGCCCTTACAAGGGTGGCCTACGCTTCCACCCATCAGTGAACCTGTCTATCCTAAAATTTTTGGGTTTTGAACAGATCTTCAAGAATGCGCTCACTGGGCTAGATATGGGCGGTGGTAAGGGTGGCCTGTGTGTGGACTTGAAAGGCAAGTCTGACAACGAGATCAGAAGGATTTGTTATGCGTTCATGAGAGAACTGAGCAGGCATATTGGTAAGGACACAGACGTGCCCGCAGGAGATATTGGTGTCGGTGGCCGTGAAATTGGCTACCTATTCGGCGCTTACAGATCATACAAGAACTCCTGGGAAGGTGTGTTGACTGGTAAGGGTTTAAACTGGGGTGGCTCACTTATCAGGCCGGAGGCCACCGGGTTCGGCTTAGTTTACTATACGCAAGCAATGATCGATTATGCAACAAACGGCAAGGAGTCGTTTGAGGGCAAACGTGTGACAATCTCCGGAAGTGGCAATGTTGCGCAATATGCAGCTTTGAAAGTGATCGAGCTGGGTGGTATTGTGGTGTCTTTATCCGATTCGAAGGGGTGCATCATCTCTGAGACGGGCATTACTTCTGAGCAAATTCACGATATCGCTTCCGCCAAGATCCGTTTCAAGTCGTTAGAGGAAATCGTTGATGAATACTCTACTTTCAGCGAAAGTAAGATGAAGTACGTTGCAGGAGCACGCCCATGGACGCATGTGAGCAACGTCGACATTGCCTTGCCCTGTGCCACCCAAAACGAGGTCAGTGGTGACGAAGCCAAGGCCCTAGTGGCATCTGGCGTTAAGTTCGTTGCCGAAGGTGCTAACATGGGTTCTACACCCGAGGCTATTTCTGTTTTCGAAACAGCGCGTAGCACTGCAACCAATGCAAAGGATGCAGTTTGGTTTGGGCCACCAAAGGCAGCTAACCTGGGCGGCGTGGCAGTATCCGGTCTGGAAATGGCTCAGAATTCTCAAAAAGTAACTTGGACTGCCGAGCGGGTCGATCAAGAACTAAAGAAGATAATGATCAACTGCTTCAACGACTGCATACAGGCCGCACAAGAGTACTCTACGGAAAAAAATACAAACACCTTGCCATCATTGGTCAAGGGGGCCAACATTGCCAGCTTCGTCATGGTGGCTGACGCAATGCTTGACCAGGGAGACGTTTTTTAG

Insert Property: Insert 1

Type Value Extra Information
Discrepancy g18a
End on reference sequence 1374
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TTTTGATTGATTGTACAGGAAAATATACATCGCAGGGGGTTGACTTTTACCATTTCACCGCAATGGAATCAAACTTGTTGAAGAGAATGTTCACAGGCGCATACGCTACAATGACCCGATTCTTGCTAGCCTTTTCTCGGTCTTGCAAACAACCGCCGGCAGCTTAGTATATAAATACACATGTACATACCTCTCTCCGTATCCTCGTAATCATTTTCTTGTATTTATCGTCTTTTCGCTGTAAAAACTTTATCACACTTATCTCAAATACACTTATTAACCGCTTTTACTATTATCTTCTACGCTGACAGTAATATCAAACAGTGACACATATTAAACACAGTGGTTTCTTTGCATAAACACCATCAGCCTCAAGTCGTCAAGTAAAGATTTCTTGTTCATGCAGATAGATAACAATCTATATGTTGATAATTAGCGTTGCCTCATCAATGCGAGATCCGTTTAACCGGACCCTAGTGCACTTACCCCACGTTCGGTCCACTGTGTGCCGAACATGCTCCTTCACTATTTTAACATGTGGAATTAATTCTCATGTTTGACAGCTTATCATCGAACTCTAAGAGGTGATACTTATTTACTGTAAAACTGTGACGATAAAACCGGAAGGAAGAATAAGAAAACTCGAACTGATCTATAATGCCTATTTTCTGTAAAGAGTTTAAGCTATGAAAGCCTCGGCATTTTGGCCGCTCCTAGGTAGTGCTTTTTTTCCAAGGACAAAACAGTATCTTTTTCTTGAGCAGGTTTTATGTTTCGGTAATCATAAACAATAAATAAATTAATTCATTTATGTTTAAAAATAAAAAGAGCCTCGGCATTTGGCCGCTCCTAGGTAGGCTTTTTTCCAGGGCCAAACAGTTTTTTTTTCTGAGCAGGTTTATGTTCGGTAATCATAAACAATAAATAAATTATTCATTTTTTTTAAAAATAAAAAATAAAAAAGTATTTTAAATTTTTAAAAAAGTTGATTATAAGCATGTGACCTTTTGCAAGCAATTAAATTTTGCAATTTGTGATTTAGGCAAAAGTTACTATTTCTGGCTCGTGTAATATATGTATGCTAATGTGAACTTTTACAAAGTCGATATGGACTTAGTCAAAAGAAATTTTCTTAAAAATATATAGCACTAGCCAATTTAGCACTTCTTTATGAGATATATTATAGACTTTATTAAGCCAGATTTGTGTATTATATGTATTTACCCGGCGAATCATGGACATACATTCTGAAATAGGTAATATTCTCTATGGTGAGACAGCATAGATAACCTAGGATACAAGTTAAAAGCTAGTACTGTTTTGCAGTAATTTTTTTCTTTTTTATAAGAATGTTACCACCTAAATAAGTTATAAAGTCAATAGTTAAGTTTGATATTTGATTGTAAAATACCGTAATATATTTGCATGATCAAAAGGCTCAATGTTGACTAGCCAGCATGTCAACCACTATATTGATCACCGATATTAGGACTTCCACACCAACTAGTAATATGACAATAAATTCAAGATATTCTTCATGAGAATGGCCCAGCGATTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACATCGAATTAATTCCTTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCTCTAGAGTCGACCATCACAAGTTTGTACAAAAAAGCAGGCTCCACCATGACAAGCGAACCAGAATTTCAGCAGGCTTACGATGAGATCGTTTCTTCTGTGGAGGATTCCAAAATTTTTGAAAAATTCCCACAGTATAAAAAAGTGTTACCTATTGTTTCTGTCCCGGAGAGGATCATTCAATTCAGGGTCACGTGGGAAAATGATAATGGCGAGCAAGAAGTGGCTCAAGGATACAGGGTGCAGTTCAATTCAGCCAAGGGCCCTTACAAGGGTGGCCTACGCTTCCACCCATCAGTGAACCTGTCTATCCTAAAATTTTTGGGTTTTGAACAGATCTTCAAGAATGCGCTCACTGGGCTAGATATGGGCGGTGGTAAGGGTGGCCTGTGTGTGGACTTGAAAGGCAAGTCTGACAACGAGATCAGAAGGATTTGTTATGCGTTCATGAGAGAACTGAGCAGGCATATTGGTAAGGACACAGACGTGCCCGCAGGAGATATTGGTGTCGGTGGCCGTGAAATTGGCTACCTATTCGGCGCTTACAGATCATACAAGAACTCCTGGGAAGGTGTGTTGACTGGTAAGGGTTTAAACTGGGGTGGCTCACTTATCAGGCCGGAGGCCACCGGGTTCGGCTTAGTTTACTATACGCAAGCAATGATCGATTATGCAACAAACGGCAAGGAGTCGTTTGAGGGCAAACGTGTGACAATCTCCGGAAGTGGCAATGTTGCGCAATATGCAGCTTTGAAAGTGATCGAGCTGGGTGGTATTGTGGTGTCTTTATCCGATTCGAAGGGGTGCATCATCTCTGAGACGGGCATTACTTCTGAGCAAATTCACGATATCGCTTCCGCCAAGATCCGTTTCAAGTCGTTAGAGGAAATCGTTGATGAATACTCTACTTTCAGCGAAAGTAAGATGAAGTACGTTGCAGGAGCACGCCCATGGACGCATGTGAGCAACGTCGACATTGCCTTGCCCTGTGCCACCCAAAACGAGGTCAGTGGTGACGAAGCCAAGGCCCTAGTGGCATCTGGCGTTAAGTTCGTTGCCGAAGGTGCTAACATGGGTTCTACACCCGAGGCTATTTCTGTTTTCGAAACAGCGCGTAGCACTGCAACCAATGCAAAGGATGCAGTTTGGTTTGGGCCACCAAAGGCAGCTAACCTGGGCGGCGTGGCAGTATCCGGTCTGGAAATGGCTCAGAATTCTCAAAAAGTAACTTGGACTGCCGAGCGGGTCGATCAAGAACTAAAGAAGATAATGATCAACTGCTTCAACGACTGCATACAGGCCGCACAAGAGTACTCTACGGAAAAAAATACAAACACCTTGCCATCATTGGTCAAGGGGGCCAACATTGCCAGCTTCGTCATGGTGGCTGACGCAATGCTTGACCAGGGAGACGTTTTTTAGGACCCAGCTTTCTTGTACAAAGTGGTGATGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGGGGGGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAGCTTTTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCCTTGAAATTTTTTTGATTCGGTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACATGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCAATTCTCATGTTTGACAGCTTATCATCGATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAGAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAAGGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCTGCAAGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGCT

Vector Information:

Vector Name:pBY011
Type:bacterial plasmid
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Properties:Gateway, acceptor (destination), inducible expression, yeast expression, yeast shuttle
Comments:This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Map:pBY011_map.pdf
Sequence:pBY011.txt
Size (bp):7920
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast uracil

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.