Clone: ScCD00095169

Clone ID:ScCD00095169
Is Verified:N
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Insert was fully sequenced in parent vector
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 239213
HIP Master Clone ID 183646
Original Clone ID FLH239213.01X

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1779 Saccharomyces cerevisiae CLOSED Genomic DNA template YHR096C HXT5 Hexose transporter with moderate affinity for glucose, may function in accumulation of reserve carbohydrates during stress, expression induced by a decrease in growth rate, contains an extended N-terminal domain relative to other HXTs
Insert1
Size (bp)1779
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YHR096C
Gene SymbolHXT5
Gene NameHexose transporter with moderate affinity for glucose, may function in accumulation of reserve carbohydrates during stress, expression induced by a decrease in growth rate, contains an extended N-terminal domain relative to other HXTs
Keyword

Insert Sequence:

ATGTCGGAACTTGAAAACGCTCATCAAGGCCCCTTGGAAGGGTCTGCTACTGTGAGCACAAATTCTAACTCATACAACGAGAAGTCAGGAAACTCGACTGCTCCTGGTACCGCCGGTTACAACGATAATTTGGCACAAGCTAAACCCGTCTCAAGTTACATTTCCCATGAAGGCCCTCCCAAAGACGAACTGGAAGAGCTTCAGAAGGAGGTTGACAAACAACTAGAGAAGAAATCGAAGTCGGATTTACTATTTGTATCCGTCTGCTGTTTGATGGTTGCTTTTGGTGGGTTCGTGTTTGGGTGGGATACTGGTACTATATCTGGTTTTGTCAGGCAAACAGACTTCATTAGGCGATTTGGCAGCACCCGTGCAAACGGGACTACCTATCTTTCCGATGTCAGAACCGGTTTGATGGTTTCTATTTTCAACATCGGCTGCGCTATCGGAGGTATAGTTTTGTCAAAGCTCGGTGATATGTATGGACGTAAGATTGGTCTGATGACTGTTGTCGTCATTTACTCAATTGGGATCATCATCCAAATCGCCTCCATTGACAAATGGTATCAATATTTCATTGGAAGAATCATCTCAGGACTGGGCGTTGGTGGTATTACAGTTTTGGCGCCTATGCTAATTTCTGAAGTGTCGCCTAAGCAGTTGCGTGGTACTCTGGTTTCATGTTACCAATTAATGATCACTTTCGGTATCTTTTTGGGATATTGTACTAATTTTGGCACCAAGAATTACTCAAACTCTGTCCAATGGAGGGTACCATTAGGCTTATGCTTTGCATGGTCTATTTTTATGATTGTTGGTATGACGTTCGTTCCTGAATCCCCACGTTATCTGGTAGAAGTGGGAAAAATTGAAGAGGCCAAGCGGTCCTTAGCAAGAGCTAACAAAACCACTGAAGACTCTCCTTTAGTAACTTTAGAAATGGAGAACTATCAGTCTTCTATTGAAGCTGAGAGATTGGCGGGCTCTGCTTCTTGGGGGGAATTGGTTACTGGTAAGCCCCAGATGTTCAGACGTACACTAATGGGTATGATGATTCAATCTTTACAACAGCTGACAGGTGACAATTACTTCTTTTACTATGGTACTACAATTTTCCAGGCTGTTGGTTTGGAAGATTCATTTGAAACTGCTATTGTTTTGGGTGTTGTTAATTTTGTTTCGACTTTTTTCTCGCTATATACCGTCGATCGTTTTGGTCGTCGTAATTGTTTGTTATGGGGCTGTGTAGGTATGATTTGTTGCTATGTCGTCTATGCCTCTGTTGGTGTTACCAGATTATGGCCAAACGGTCAAGATCAACCATCTTCAAAGGGTGCTGGTAACTGTATGATTGTTTTCGCATGTTTCTACATTTTCTGTTTCGCTACCACTTGGGCCCCCGTTGCCTATGTCCTTATCTCTGAGTCGTATCCCTTAAGAGTACGTGGTAAAGCAATGTCGATTGCAAGTGCCTGTAACTGGATTTGGGGGTTCTTGATCAGTTTTTTCACTCCATTTATTACTTCAGCAATCAATTTCTATTATGGCTATGTCTTTATGGGTTGTATGGTGTTCGCATACTTTTATGTGTTCTTCTTTGTTCCAGAGACAAAGGGCTTAACATTAGAAGAAGTCAACGAAATGTATGAAGAAAATGTGCTACCTTGGAAGTCTACCAAATGGATCCCACCATCTAGGAGAACAACAGATTATGACCTAGACGCTACTAGAAATGATCCGAGACCATTTTATAAAAGGATGTTCACTAAAGAAAAATAG

Insert Property: Insert 1

Type Value Extra Information
Discrepancy t738c
End on reference sequence 1779
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

TTTTGATTGATTGTACAGGAAAATATACATCGCAGGGGGTTGACTTTTACCATTTCACCGCAATGGAATCAAACTTGTTGAAGAGAATGTTCACAGGCGCATACGCTACAATGACCCGATTCTTGCTAGCCTTTTCTCGGTCTTGCAAACAACCGCCGGCAGCTTAGTATATAAATACACATGTACATACCTCTCTCCGTATCCTCGTAATCATTTTCTTGTATTTATCGTCTTTTCGCTGTAAAAACTTTATCACACTTATCTCAAATACACTTATTAACCGCTTTTACTATTATCTTCTACGCTGACAGTAATATCAAACAGTGACACATATTAAACACAGTGGTTTCTTTGCATAAACACCATCAGCCTCAAGTCGTCAAGTAAAGATTTCTTGTTCATGCAGATAGATAACAATCTATATGTTGATAATTAGCGTTGCCTCATCAATGCGAGATCCGTTTAACCGGACCCTAGTGCACTTACCCCACGTTCGGTCCACTGTGTGCCGAACATGCTCCTTCACTATTTTAACATGTGGAATTAATTCTCATGTTTGACAGCTTATCATCGAACTCTAAGAGGTGATACTTATTTACTGTAAAACTGTGACGATAAAACCGGAAGGAAGAATAAGAAAACTCGAACTGATCTATAATGCCTATTTTCTGTAAAGAGTTTAAGCTATGAAAGCCTCGGCATTTTGGCCGCTCCTAGGTAGTGCTTTTTTTCCAAGGACAAAACAGTATCTTTTTCTTGAGCAGGTTTTATGTTTCGGTAATCATAAACAATAAATAAATTAATTCATTTATGTTTAAAAATAAAAAGAGCCTCGGCATTTGGCCGCTCCTAGGTAGGCTTTTTTCCAGGGCCAAACAGTTTTTTTTTCTGAGCAGGTTTATGTTCGGTAATCATAAACAATAAATAAATTATTCATTTTTTTTAAAAATAAAAAATAAAAAAGTATTTTAAATTTTTAAAAAAGTTGATTATAAGCATGTGACCTTTTGCAAGCAATTAAATTTTGCAATTTGTGATTTAGGCAAAAGTTACTATTTCTGGCTCGTGTAATATATGTATGCTAATGTGAACTTTTACAAAGTCGATATGGACTTAGTCAAAAGAAATTTTCTTAAAAATATATAGCACTAGCCAATTTAGCACTTCTTTATGAGATATATTATAGACTTTATTAAGCCAGATTTGTGTATTATATGTATTTACCCGGCGAATCATGGACATACATTCTGAAATAGGTAATATTCTCTATGGTGAGACAGCATAGATAACCTAGGATACAAGTTAAAAGCTAGTACTGTTTTGCAGTAATTTTTTTCTTTTTTATAAGAATGTTACCACCTAAATAAGTTATAAAGTCAATAGTTAAGTTTGATATTTGATTGTAAAATACCGTAATATATTTGCATGATCAAAAGGCTCAATGTTGACTAGCCAGCATGTCAACCACTATATTGATCACCGATATTAGGACTTCCACACCAACTAGTAATATGACAATAAATTCAAGATATTCTTCATGAGAATGGCCCAGCGATTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACATCGAATTAATTCCTTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCTCTAGAGTCGACCATCACAAGTTTGTACAAAAAAGCAGGCTCCACCATGTCGGAACTTGAAAACGCTCATCAAGGCCCCTTGGAAGGGTCTGCTACTGTGAGCACAAATTCTAACTCATACAACGAGAAGTCAGGAAACTCGACTGCTCCTGGTACCGCCGGTTACAACGATAATTTGGCACAAGCTAAACCCGTCTCAAGTTACATTTCCCATGAAGGCCCTCCCAAAGACGAACTGGAAGAGCTTCAGAAGGAGGTTGACAAACAACTAGAGAAGAAATCGAAGTCGGATTTACTATTTGTATCCGTCTGCTGTTTGATGGTTGCTTTTGGTGGGTTCGTGTTTGGGTGGGATACTGGTACTATATCTGGTTTTGTCAGGCAAACAGACTTCATTAGGCGATTTGGCAGCACCCGTGCAAACGGGACTACCTATCTTTCCGATGTCAGAACCGGTTTGATGGTTTCTATTTTCAACATCGGCTGCGCTATCGGAGGTATAGTTTTGTCAAAGCTCGGTGATATGTATGGACGTAAGATTGGTCTGATGACTGTTGTCGTCATTTACTCAATTGGGATCATCATCCAAATCGCCTCCATTGACAAATGGTATCAATATTTCATTGGAAGAATCATCTCAGGACTGGGCGTTGGTGGTATTACAGTTTTGGCGCCTATGCTAATTTCTGAAGTGTCGCCTAAGCAGTTGCGTGGTACTCTGGTTTCATGTTACCAATTAATGATCACTTTCGGTATCTTTTTGGGATATTGTACTAATTTTGGCACCAAGAATTACTCAAACTCTGTCCAATGGAGGGTACCATTAGGCTTATGCTTTGCATGGTCTATTTTTATGATTGTTGGTATGACGTTCGTTCCTGAATCCCCACGTTATCTGGTAGAAGTGGGAAAAATTGAAGAGGCCAAGCGGTCCTTAGCAAGAGCTAACAAAACCACTGAAGACTCTCCTTTAGTAACTTTAGAAATGGAGAACTATCAGTCTTCTATTGAAGCTGAGAGATTGGCGGGCTCTGCTTCTTGGGGGGAATTGGTTACTGGTAAGCCCCAGATGTTCAGACGTACACTAATGGGTATGATGATTCAATCTTTACAACAGCTGACAGGTGACAATTACTTCTTTTACTATGGTACTACAATTTTCCAGGCTGTTGGTTTGGAAGATTCATTTGAAACTGCTATTGTTTTGGGTGTTGTTAATTTTGTTTCGACTTTTTTCTCGCTATATACCGTCGATCGTTTTGGTCGTCGTAATTGTTTGTTATGGGGCTGTGTAGGTATGATTTGTTGCTATGTCGTCTATGCCTCTGTTGGTGTTACCAGATTATGGCCAAACGGTCAAGATCAACCATCTTCAAAGGGTGCTGGTAACTGTATGATTGTTTTCGCATGTTTCTACATTTTCTGTTTCGCTACCACTTGGGCCCCCGTTGCCTATGTCCTTATCTCTGAGTCGTATCCCTTAAGAGTACGTGGTAAAGCAATGTCGATTGCAAGTGCCTGTAACTGGATTTGGGGGTTCTTGATCAGTTTTTTCACTCCATTTATTACTTCAGCAATCAATTTCTATTATGGCTATGTCTTTATGGGTTGTATGGTGTTCGCATACTTTTATGTGTTCTTCTTTGTTCCAGAGACAAAGGGCTTAACATTAGAAGAAGTCAACGAAATGTATGAAGAAAATGTGCTACCTTGGAAGTCTACCAAATGGATCCCACCATCTAGGAGAACAACAGATTATGACCTAGACGCTACTAGAAATGATCCGAGACCATTTTATAAAAGGATGTTCACTAAAGAAAAATAGGACCCAGCTTTCTTGTACAAAGTGGTGATGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGGGGGGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTAGCTTTTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCCTTGAAATTTTTTTGATTCGGTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACATGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCAATTCTCATGTTTGACAGCTTATCATCGATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAGAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAAGGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCTGCAAGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGCT

Sequencing Information:

Phred Score: 880
Date: 2016-05-25

Last Passing Sequencing Read:

NNNGGGCTAGGGTACGCTAGACCTGATACGCCAGCTTGCTGCCATCACCACTTTGTACAGAAAGCTGGGTCCTATTTTTCTTTAGTGAACATCCTTTTATAAAATGGTCTCGGATCATTTCTAGTAGCGTCTAGGTCATAATCTGTTGTTCTCCTAGATGGTGGGATCCATTTGGTAGACTTCCAAGGTAGCACATTTTCTTCATACATTTCGTTGACTTCTTCTAATGTTAAGCCCTTTGTCTCTGGAACAAAGAAGAACACATAAAAGTATGCGAACACCATACAACCCATAAAGACATAGCCATAATAGAAATTGATTGCTGAAGTAATAAATGGAGTGAAAAAACTGATCAAGAACCCCCAAATCCAGTTACAGGCACTTGCAATCGACATTGCTTTACCACGTACTCTTAAGGGATACGACTCAGAGATAAGGACATAGGCAACGGGGGCCCAAGTGGTAGCGAAACAGAAAATGTAGAAACATGCGAAAACAATCATACAGTTACCAGCACCCTTTGAAGATGGTTGATCTTGACCGTTTGGCCATAATCTGGTAACACCAACAGAGGCATAGACGACATAGCAACAAATCATACCTACACAGCCCCATAACAAACAATTACGACGACCAAAACGATCGACGGTATATAGCGAGAAAAAAGTCGAAACAAAATTAACAACACCCAAAACAATAGCAGTTTCAAATGAATCTTCCAAACCAACAGCCTGGAAAATTGTAGTACCATAGTAAAAGAAGTAATTGTCACCTGTCAGCTGTTGTAAAGATTGAATCATCATACCCATTAGTGTACGTCTGAACATCTGGGGCTTACCAGTAACCAATTCCCCCCAAGAAGCAGAGCCCGCCAATCTCTCAGCTTCAATAGAAGACTGATAGTTCTCCATTTCTAAAGTACTAAAGGAGAGTCTTCAGTGGTTTTGTTAGCTCTTGCTAANGACCGCTTGGCCTCTTTCATTTTTCCCACTTCTACCAGATACGTGGGGATTCAGGAACGAACGTCATACCAACAATCATTAAAATAGACCATGCAAAGCATAACCCTATGTTACCCTCCATTGGAAGAGTTTGAGTATTTCTTGGTGCAAAATTAGTACAATATCCCAAAAGATACCGAAAGTGATCATTATTGTTAACATGAAACAGAATACCCCGCACTGCTTAGGCGACCTTTCAAAATAGCATAGGGCCCAACTGTAAACCACCAAGCCCGTCCGGAAAGATTCTCCATGGAAATTGAATCCTTGCCAAGGAGGGCATTGAGAAATTCAATTGAATAAGAAGAAACGTTTAGACATTTTATCTCATATTCCGGATTGAAAAATTACCCCAAGGCGCCGAGTGTAAATAACCTCCACGGTCTCACCCAAAAGAGA

Vector Information:

Vector Name:pBY011
Type:bacterial plasmid
Description:Yeast expression vector with ARS1, CEN4, Gal1-10 promoter; amp resistance (URA3 for yeast); recombinational cloning.
Properties:Gateway, acceptor (destination), inducible expression, yeast expression, yeast shuttle
Comments:This is a bacteria-yeast shuttle vector useful for expressing cDNAs in yeast that includes an auxotrophic marker for selection in yeast.
Map:pBY011_map.pdf
Sequence:pBY011.txt
Size (bp):7920
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
yeast uracil

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.