Clone: ScCD00094005

Clone ID:ScCD00094005
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 6643
Original Clone ID FLH007085.01X
HIP Clone ID 7085

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 471 Saccharomyces cerevisiae CLOSED Genomic DNA template YPR193C HPA2 Tetrameric histone acetyltransferase with similarity to Gcn5p, Hat1p, Elp3p, and Hpa3p; acetylates histones H3 and H4 in vitro and exhibits autoacetylation activity
Insert1
Size (bp)471
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YPR193C
Gene SymbolHPA2
Gene NameTetrameric histone acetyltransferase with similarity to Gcn5p, Hat1p, Elp3p, and Hpa3p; acetylates histones H3 and H4 in vitro and exhibits autoacetylation activity
Keyword

Insert Sequence:

ATGTCCAACACTAGCGAAGATAACATTACCGTAAGGTTTGTAACCGAAAACGATAAGGAGGGTTGGCAAAGGCTTTGGAAATCCTATCAAGATTTTTATGAAGTCTCTTTTCCCGATGACTTGGACGATTTCAATTTCGGCAGATTCCTAGATCCTAACATTAAAATGTGGGCAGCCGTAGCTGTGGAAAGTTCGAGCGAAAAAATTATTGGAATGATAAACTTTTTCAACCATATGACTACTTGGGATTTCAAGGACAAGATATACATCAACGATCTCTATGTTGATGAGAATTCTAGGGTCAAAGGCGCGGGCGGCAAACTAATCCAATTTGTCTACGACGAAGCTGATAAACTGGGCACACCAAGCGTGTATTGGTGTACGGATGAGTCAAACCATAGAGCTCAGCTGCTATACGTCAAGGTCGGCTATAAAGCCCCAAAAATATTATACAAGAGGAAGGGATATTAA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 471
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCCAACACTAGCGAAGATAACATTACCGTAAGGTTTGTAACCGAAAACGATAAGGAGGGTTGGCAAAGGCTTTGGAAATCCTATCAAGATTTTTATGAAGTCTCTTTTCCCGATGACTTGGACGATTTCAATTTCGGCAGATTCCTAGATCCTAACATTAAAATGTGGGCAGCCGTAGCTGTGGAAAGTTCGAGCGAAAAAATTATTGGAATGATAAACTTTTTCAACCATATGACTACTTGGGATTTCAAGGACAAGATATACATCAACGATCTCTATGTTGATGAGAATTCTAGGGTCAAAGGCGCGGGCGGCAAACTAATCCAATTTGTCTACGACGAAGCTGATAAACTGGGCACACCAAGCGTGTATTGGTGTACGGATGAGTCAAACCATAGAGCTCAGCTGCTATACGTCAAGGTCGGCTATAAAGCCCCAAAAATATTATACAAGAGGAAGGGATATTAAGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pDONR201
Type:bacterial plasmid
Description:Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr201_pdonr207_map.pdf
Sequence:pDONR201_FASTA.txt
Size (bp):4470
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute