Clone: ScCD00093620

Clone ID:ScCD00093620
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 3401
Original Clone ID FLH003843.01X
HIP Clone ID 3843

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 477 Saccharomyces cerevisiae CLOSED Genomic DNA template YJL143W TIM17 Essential constituent of the mitochondrial inner membrane presequence translocase; interacts with Pam18p to recruit the presequence translocase-associated motor (PAM complex) and also required for protein sorting during import
Insert1
Size (bp)477
SpeciesSaccharomyces cerevisiae
FormatCLOSED
Tissue SourceGenomic DNA template
Species Specific ID YJL143W
Gene SymbolTIM17
Gene NameEssential constituent of the mitochondrial inner membrane presequence translocase; interacts with Pam18p to recruit the presequence translocase-associated motor (PAM complex) and also required for protein sorting during import
Keyword

Insert Sequence:

ATGTCAGCCGATCATTCGAGAGATCCATGTCCTATAGTCATACTAAATGATTTCGGTGGTGCTTTTGCCATGGGTGCCATTGGTGGTGTTGTTTGGCATGGGATTAAAGGTTTTAGAAATTCGCCATTAGGTGAGCGTGGTTCAGGAGCTATGAGCGCCATTAAAGCGCGTGCTCCCGTACTGGGTGGTAATTTTGGTGTGTGGGGTGGTTTATTTTCGACTTTTGATTGCGCTGTGAAGGCCGTTAGAAAGAGAGAGGACCCATGGAATGCTATCATTGCAGGGTTTTTCACTGGTGGCGCTTTAGCTGTAAGAGGTGGTTGGAGGCATACAAGGAACAGTTCGATCACGTGTGCTTGTTTGTTGGGTGTGATTGAAGGTGTGGGACTAATGTTTCAAAGATATGCTGCTTGGCAAGCCAAACCTATGGCTCCTCCTTTGCCCGAAGCACCTTCCTCTCAACCTCTGCAAGCTTAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 477
Start on reference sequence 1

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCAGCCGATCATTCGAGAGATCCATGTCCTATAGTCATACTAAATGATTTCGGTGGTGCTTTTGCCATGGGTGCCATTGGTGGTGTTGTTTGGCATGGGATTAAAGGTTTTAGAAATTCGCCATTAGGTGAGCGTGGTTCAGGAGCTATGAGCGCCATTAAAGCGCGTGCTCCCGTACTGGGTGGTAATTTTGGTGTGTGGGGTGGTTTATTTTCGACTTTTGATTGCGCTGTGAAGGCCGTTAGAAAGAGAGAGGACCCATGGAATGCTATCATTGCAGGGTTTTTCACTGGTGGCGCTTTAGCTGTAAGAGGTGGTTGGAGGCATACAAGGAACAGTTCGATCACGTGTGCTTGTTTGTTGGGTGTGATTGAAGGTGTGGGACTAATGTTTCAAAGATATGCTGCTTGGCAAGCCAAACCTATGGCTCCTCCTTTGCCCGAAGCACCTTCCTCTCAACCTCTGCAAGCTTAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pDONR201
Type:bacterial plasmid
Description:Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr201_pdonr207_map.pdf
Sequence:pDONR201_FASTA.txt
Size (bp):4470
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute