Clone: HsCD00082922

Clone ID:HsCD00082922
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Master Clone ID 201301
IMAGE ID 100015759
HIP Clone ID 269799
GenBank Accession BC148740
Original Clone ID FLH269799.01X
GI 151555536

Property:

Collection: NIH_MGC_428
Collection: OCAB14
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1347 Homo sapiens CLOSED 3882 KRTHA2 keratin, hair, acidic, 2
Insert1
Size (bp)1347
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 3882
Gene SymbolKRTHA2
Gene Namekeratin, hair, acidic, 2
Keyword

Insert Sequence:

ATGACATCCTCCTGCTGTGTCACCAACAACTTGCAAGCCTCTCTCAAGAGCTGCCCCCGGCCTGCCTCGGTCTGTTCCAGCGGCGTGAACTGCCGGCCTGAGCTGTGCCTGGGCTATGTCTGCCAGCCCATGGCATGCCTGCCTTCGGTCTGCCTGCCCACCACCTTCCGGCCAGCCAGCTGCCTCTCCAAAACCTATCTATCCAGTTCCTGCCAGGCAGCCAGTGGCATCTCCGGCTCCATGGGCCCCGGCAGCTGGTACAGCGAAGGGGCCTTCAATGGCAATGAGAAGGAAACCATGCAGTTCCTTAACGACCGCCTGGCCAGCTACCTGACGAGGGTGCGGCAGCTGGAGCAGGAGAATGCGGAGCTGGAGAGCAGGATCCAAGAGGCCTCTCACTCCCAGGTGCTCACCATGACTCCTGACTACCAGTCTCATTTCAGGACCATTGAGGAGCTCCAGCAGAAGATTCTGTGTACCAAGGCAGAGAATGCCAGGATGGTTGTGAACATTGATAATGCCAAACTGGCTGCCGATGACTTCAGGGCCAAGTACGAGGCAGAGCTGGCCATGCGGCAGCTGGTGGAGGCCGACATCAATGGCCTGCGCAGGATCCTGGATGATCTCACTCTGTGCAAGGCTGACCTGGAGGCCCAGGTTGAGTCCCTGAAGGAGGAGCTGATGTGCCTCAAAAAGAACCATGAGGAGGAAGTCGGTTCCCTTCGATGCCAGCTTGGGGACCGCCTTAACATCGAGGTGGACGCTGCACCCCCGGTGGACCTGACCAGGGTGCTGGAGGAGATGCGGTGTCAGTACGAGGCCATGGTGGAGGCCAACCGCAGGGACGTGGAGGAATGGTTCAATATGCAGATGGAGGAGCTTAACCAACAGGTGGCCACAAGCTCTGAGCAGCTTCAGAACTACCAGTCAGACATCATTGACCTGAGACGCACGGTCAACACGCTGGAGATCGAGCTGCAGGCCCAGCACAGCCTGAGGGACTCCCTGGAAAACACGCTGACGGAGAGTGAGGCCCGCTACAGCTCCCAGCTGGCCCAGATGCAGTGCATGATCACCAACGTTGAGGCCCAGCTGGCTGAGATCCGGGCTGACCTGGAGCGGCAGAACCAGGAGTACCAGGTGCTGCTGGACGTCCGGGCCCGGCTGGAGGGCGAGATCAACACGTACCGGAGCCTGCTGGAGAACGAGGACTGCAAGCTGCCCTGTAACCCATGCTCCACTCCTTCCTGCACCACCTGTGTGCCCTCCCCATGCGTGCCCCGCACCGTCTGTGTGCCACGCACTGTTGGCATGCCTTGCTCACCCTGCCCCCAGGGCCGCTACTAA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1408
Start on reference sequence 62

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTATGACATCCTCCTGCTGTGTCACCAACAACTTGCAAGCCTCTCTCAAGAGCTGCCCCCGGCCTGCCTCGGTCTGTTCCAGCGGCGTGAACTGCCGGCCTGAGCTGTGCCTGGGCTATGTCTGCCAGCCCATGGCATGCCTGCCTTCGGTCTGCCTGCCCACCACCTTCCGGCCAGCCAGCTGCCTCTCCAAAACCTATCTATCCAGTTCCTGCCAGGCAGCCAGTGGCATCTCCGGCTCCATGGGCCCCGGCAGCTGGTACAGCGAAGGGGCCTTCAATGGCAATGAGAAGGAAACCATGCAGTTCCTTAACGACCGCCTGGCCAGCTACCTGACGAGGGTGCGGCAGCTGGAGCAGGAGAATGCGGAGCTGGAGAGCAGGATCCAAGAGGCCTCTCACTCCCAGGTGCTCACCATGACTCCTGACTACCAGTCTCATTTCAGGACCATTGAGGAGCTCCAGCAGAAGATTCTGTGTACCAAGGCAGAGAATGCCAGGATGGTTGTGAACATTGATAATGCCAAACTGGCTGCCGATGACTTCAGGGCCAAGTACGAGGCAGAGCTGGCCATGCGGCAGCTGGTGGAGGCCGACATCAATGGCCTGCGCAGGATCCTGGATGATCTCACTCTGTGCAAGGCTGACCTGGAGGCCCAGGTTGAGTCCCTGAAGGAGGAGCTGATGTGCCTCAAAAAGAACCATGAGGAGGAAGTCGGTTCCCTTCGATGCCAGCTTGGGGACCGCCTTAACATCGAGGTGGACGCTGCACCCCCGGTGGACCTGACCAGGGTGCTGGAGGAGATGCGGTGTCAGTACGAGGCCATGGTGGAGGCCAACCGCAGGGACGTGGAGGAATGGTTCAATATGCAGATGGAGGAGCTTAACCAACAGGTGGCCACAAGCTCTGAGCAGCTTCAGAACTACCAGTCAGACATCATTGACCTGAGACGCACGGTCAACACGCTGGAGATCGAGCTGCAGGCCCAGCACAGCCTGAGGGACTCCCTGGAAAACACGCTGACGGAGAGTGAGGCCCGCTACAGCTCCCAGCTGGCCCAGATGCAGTGCATGATCACCAACGTTGAGGCCCAGCTGGCTGAGATCCGGGCTGACCTGGAGCGGCAGAACCAGGAGTACCAGGTGCTGCTGGACGTCCGGGCCCGGCTGGAGGGCGAGATCAACACGTACCGGAGCCTGCTGGAGAACGAGGACTGCAAGCTGCCCTGTAACCCATGCTCCACTCCTTCCTGCACCACCTGTGTGCCCTCCCCATGCGTGCCCCGCACCGTCTGTGTGCCACGCACTGTTGGCATGCCTTGCTCACCCTGCCCCCAGGGCCGCTACTAATACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium