Clone: HsCD00082618

Clone ID:HsCD00082618
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC111460
Original Clone ID FLH267395.01L
HIP Master Clone ID 199524
HIP Clone ID 267395
IMAGE ID 40080650
GI 109939884

Property:

Collection: NIH_MGC_370
Collection: OCAB7
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2862 Homo sapiens FUSION 4294 MAP3K10 mitogen-activated protein kinase kinase kinase 10
Insert1
Size (bp)2862
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 4294
Gene SymbolMAP3K10
Gene Namemitogen-activated protein kinase kinase kinase 10
Keyword

Insert Sequence:

ATGGAGGAGGAGGAGGGGGCGGTGGCCAAGGAGTGGGGCACGACCCCCGCGGGGCCCGTCTGGACCGCGGTGTTCGACTACGAGGCGGCGGGCGACGAGGAGCTGACCCTGCGGAGGGGCGATCGCGTCCAGGTGCTTTCCCAAGACTGTGCGGTGTCCGGCGACGAGGGCTGGTGGACCGGGCAGCTCCCCAGCGGCCGCGTGGGCGTCTTCCCCAGCAACTACGTGGCCCCCGGCGCCCCCGCTGCACCCGCGGGCCTCCAGCTGCCCCAGGAGATCCCCTTCCACGAGCTGCAGCTAGAGGAGATCATCGGTGTGGGGGGCTTTGGCAAGGTCTATCGGGCCCTGTGGCGTGGCGAGGAGGTGGCAGTCAAGGCCGCCCGGCTGGACCCTGAGAAGGACCCGGCAGTGACAGCGGAGCAGGTGTGCCAGGAAGCCCGGCTCTTTGGAGCCCTGCAGCACCCCAACATAATTGCCCTTAGGGGCGCCTGCCTCAACCCCCCACACCTCTGCCTAGTGATGGAGTATGCCCGGGGTGGTGCACTGAGCAGGGTGCTGGCAGGTCGCCGGGTGCCACCTCACGTGCTGGTCAACTGGGCTGTGCAGGTGGCCCGGGGCATGAACTACCTACACAATGATGCCCCTGTGCCCATCATCCACCGGGACCTCAAGTCCATCAACATCCTGATCCTGGAGGCCATCGAGAACCACAACCTCGCAGACACGGTGCTCAAGATCACGGACTTCGGCCTCGCCCGCGAGTGGCACAAGACCACCAAGATGAGCGCTGCGGGGACCTACGCCTGGATGGCGCCGGAGGTTATCCGTCTCTCCCTCTTCTCCAAAAGCAGTGATGTCTGGAGCTTCGGGGTGCTGCTGTGGGAGCTGCTGACGGGGGAGGTCCCCTACCGTGAGATCGACGCCTTGGCCGTGGCGTATGGCGTGGCTATGAATAAGCTGACGCTGCCCATTCCCTCCACGTGCCCCGAGCCCTTTGCCCGCCTCCTGGAGGAATGCTGGGACCCAGACCCCCACGGGCGGCCAGATTTCGGTAGCATCTTGAAGCGGCTTGAAGTCATCGAACAGTCAGCCCTGTTCCAGATGCCACTGGAGTCCTTCCACTCGCTGCAGGAAGACTGGAAGCTGGAGATTCAGCACATGTTTGATGACCTTCGGACCAAGGAGAAGGAGCTTCGGAGCCGTGAGGAGGAGCTGCTGCGGGCGGCACAGGAGCAGCGCTTCCAGGAGGAGCAGCTGCGGCGGCGGGAGCAGGAGCTGGCAGAACGTGAGATGGACATCGTGGAACGGGAGCTGCACCTGCTCATGTGCCAGCTGAGCCAGGAGAAGCCCCGGGTCCGCAAGCGCAAGGGCAACTTCAAGCGCAGCCGCCTGCTCAAGCTGCGGGAAGGCGGCAGCCACATCAGCCTGCCCTCTGGCTTTGAGCATAAGATCACAGTCCAGGCCTCTCCAACTCTGGATAAGCGGAAAGGATCCGATGGGGCCAGCCCCCCTGCAAGCCCCAGCATCATCCCCCGGCTGAGGGCCATTCGCCTGACTCCCGTGGACTGTGGTGGCAGCAGCAGTGGCAGCAGCAGTGGAGGAAGTGGGACATGGAGCCGCGGTGGGCCCCCAAAGAAGGAAGAACTGGTCGGGGGCAAGAAGAAGGGACGAACGTGGGGGCCCAGCTCCACCCTGCAGAAGGAGCGGGTGGGAGGAGAGGAGAGGCTGAAGGGGCTGGGGGAAGGAAGCAAACAGTGGTCATCAAGTGCCCCCAACCTGGGCAAGTCCCCCAAACACACACCCATCGCCCCTGGCTTTGCCAGCCTCAATGAGATGGAGGAGTTCGCGGAGGCAGAGGATGGAGGCAGCAGCGTGCCCCCTTCCCCCTACTCGACCCCGTCCTACCTCTCAGTGCCACTGCCTGCCGAGCCCTCCCCGGGGGCGCGGGCGCCGTGGGAGCCGACGCCGTCCGCGCCCCCCGCTCGGTGGGGACACGGCGCCCGGCGGCGCTGCGACCTGGCGCTGCTAGGCTGCGCCACGCTGCTGGGGGCTGTGGGCCTGGGCGCCGACGTGGCCGAGGCGCGCGCGGCCGACGGTGAGGAGCAGCGGCGCTGGCTCGACGGCCTCTTCTTTCCCCGCGCCGGCCGCTTCCCGCGGGGCCTCAGCCCACCCGCGCGTCCCCACGGCCGCCGCGAAGACGTGGGCCCCGGCCTGGGCCTGGCGCCCTCGGCCACCCTCGTGTCGCTGTCGTCCGTGTCCGACTGCAACTCCACGCGTTCACTGCTGCGCTCTGACAGTGACGAGGCCGCACCGGCCGCGCCCTCCCCACCACCCTCCCCGCCCGCGCCCACACCCACGCCCTCGCCCAGCACCAACCCCCTGGTGGACCTGGAGCTGGAGAGCTTCAAGAAGGACCCCCGCCAGTCGCTCACGCCCACCCACGTCACGGCTGCATGCGCTGTGAGCCGCGGGCACCGGCGGACGCCATCGGACGGGGCGCTGGGGCAGCGGGGGCCGCCCGAGCCCGCGGGCCATGGCCCTGGCCCTCGTGACCTTCTGGACTTCCCCCGCCTGCCCGACCCCCAGGCCCTGTTCCCAGCCCGCCGCCGGCCCCCTGAGTTCCCAGGCCGCCCCACCACCCTGACCTTTGCCCCGAGACCTCGGCCGGCTGCCAGTCGCCCCCGCTTGGACCCCTGGAAACTGGTCTCCTTCGGCCGGACACTCACCATCTCGCCTCCCAGCAGGCCAGACACTCCGGAGAGCCCTGGGCCCCCCAGCGTGCAGCCCACACTGCTGGACATGGACATGGAGGGGCAGAACCAAGACAGCACAGTGCCCCTGTGCGGGGCCCACGGCTCCCAC

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 2896
Start on reference sequence 35

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGAGGAGGAGGAGGGGGCGGTGGCCAAGGAGTGGGGCACGACCCCCGCGGGGCCCGTCTGGACCGCGGTGTTCGACTACGAGGCGGCGGGCGACGAGGAGCTGACCCTGCGGAGGGGCGATCGCGTCCAGGTGCTTTCCCAAGACTGTGCGGTGTCCGGCGACGAGGGCTGGTGGACCGGGCAGCTCCCCAGCGGCCGCGTGGGCGTCTTCCCCAGCAACTACGTGGCCCCCGGCGCCCCCGCTGCACCCGCGGGCCTCCAGCTGCCCCAGGAGATCCCCTTCCACGAGCTGCAGCTAGAGGAGATCATCGGTGTGGGGGGCTTTGGCAAGGTCTATCGGGCCCTGTGGCGTGGCGAGGAGGTGGCAGTCAAGGCCGCCCGGCTGGACCCTGAGAAGGACCCGGCAGTGACAGCGGAGCAGGTGTGCCAGGAAGCCCGGCTCTTTGGAGCCCTGCAGCACCCCAACATAATTGCCCTTAGGGGCGCCTGCCTCAACCCCCCACACCTCTGCCTAGTGATGGAGTATGCCCGGGGTGGTGCACTGAGCAGGGTGCTGGCAGGTCGCCGGGTGCCACCTCACGTGCTGGTCAACTGGGCTGTGCAGGTGGCCCGGGGCATGAACTACCTACACAATGATGCCCCTGTGCCCATCATCCACCGGGACCTCAAGTCCATCAACATCCTGATCCTGGAGGCCATCGAGAACCACAACCTCGCAGACACGGTGCTCAAGATCACGGACTTCGGCCTCGCCCGCGAGTGGCACAAGACCACCAAGATGAGCGCTGCGGGGACCTACGCCTGGATGGCGCCGGAGGTTATCCGTCTCTCCCTCTTCTCCAAAAGCAGTGATGTCTGGAGCTTCGGGGTGCTGCTGTGGGAGCTGCTGACGGGGGAGGTCCCCTACCGTGAGATCGACGCCTTGGCCGTGGCGTATGGCGTGGCTATGAATAAGCTGACGCTGCCCATTCCCTCCACGTGCCCCGAGCCCTTTGCCCGCCTCCTGGAGGAATGCTGGGACCCAGACCCCCACGGGCGGCCAGATTTCGGTAGCATCTTGAAGCGGCTTGAAGTCATCGAACAGTCAGCCCTGTTCCAGATGCCACTGGAGTCCTTCCACTCGCTGCAGGAAGACTGGAAGCTGGAGATTCAGCACATGTTTGATGACCTTCGGACCAAGGAGAAGGAGCTTCGGAGCCGTGAGGAGGAGCTGCTGCGGGCGGCACAGGAGCAGCGCTTCCAGGAGGAGCAGCTGCGGCGGCGGGAGCAGGAGCTGGCAGAACGTGAGATGGACATCGTGGAACGGGAGCTGCACCTGCTCATGTGCCAGCTGAGCCAGGAGAAGCCCCGGGTCCGCAAGCGCAAGGGCAACTTCAAGCGCAGCCGCCTGCTCAAGCTGCGGGAAGGCGGCAGCCACATCAGCCTGCCCTCTGGCTTTGAGCATAAGATCACAGTCCAGGCCTCTCCAACTCTGGATAAGCGGAAAGGATCCGATGGGGCCAGCCCCCCTGCAAGCCCCAGCATCATCCCCCGGCTGAGGGCCATTCGCCTGACTCCCGTGGACTGTGGTGGCAGCAGCAGTGGCAGCAGCAGTGGAGGAAGTGGGACATGGAGCCGCGGTGGGCCCCCAAAGAAGGAAGAACTGGTCGGGGGCAAGAAGAAGGGACGAACGTGGGGGCCCAGCTCCACCCTGCAGAAGGAGCGGGTGGGAGGAGAGGAGAGGCTGAAGGGGCTGGGGGAAGGAAGCAAACAGTGGTCATCAAGTGCCCCCAACCTGGGCAAGTCCCCCAAACACACACCCATCGCCCCTGGCTTTGCCAGCCTCAATGAGATGGAGGAGTTCGCGGAGGCAGAGGATGGAGGCAGCAGCGTGCCCCCTTCCCCCTACTCGACCCCGTCCTACCTCTCAGTGCCACTGCCTGCCGAGCCCTCCCCGGGGGCGCGGGCGCCGTGGGAGCCGACGCCGTCCGCGCCCCCCGCTCGGTGGGGACACGGCGCCCGGCGGCGCTGCGACCTGGCGCTGCTAGGCTGCGCCACGCTGCTGGGGGCTGTGGGCCTGGGCGCCGACGTGGCCGAGGCGCGCGCGGCCGACGGTGAGGAGCAGCGGCGCTGGCTCGACGGCCTCTTCTTTCCCCGCGCCGGCCGCTTCCCGCGGGGCCTCAGCCCACCCGCGCGTCCCCACGGCCGCCGCGAAGACGTGGGCCCCGGCCTGGGCCTGGCGCCCTCGGCCACCCTCGTGTCGCTGTCGTCCGTGTCCGACTGCAACTCCACGCGTTCACTGCTGCGCTCTGACAGTGACGAGGCCGCACCGGCCGCGCCCTCCCCACCACCCTCCCCGCCCGCGCCCACACCCACGCCCTCGCCCAGCACCAACCCCCTGGTGGACCTGGAGCTGGAGAGCTTCAAGAAGGACCCCCGCCAGTCGCTCACGCCCACCCACGTCACGGCTGCATGCGCTGTGAGCCGCGGGCACCGGCGGACGCCATCGGACGGGGCGCTGGGGCAGCGGGGGCCGCCCGAGCCCGCGGGCCATGGCCCTGGCCCTCGTGACCTTCTGGACTTCCCCCGCCTGCCCGACCCCCAGGCCCTGTTCCCAGCCCGCCGCCGGCCCCCTGAGTTCCCAGGCCGCCCCACCACCCTGACCTTTGCCCCGAGACCTCGGCCGGCTGCCAGTCGCCCCCGCTTGGACCCCTGGAAACTGGTCTCCTTCGGCCGGACACTCACCATCTCGCCTCCCAGCAGGCCAGACACTCCGGAGAGCCCTGGGCCCCCCAGCGTGCAGCCCACACTGCTGGACATGGACATGGAGGGGCAGAACCAAGACAGCACAGTGCCCCTGTGCGGGGCCCACGGCTCCCACGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 795
Date: 2014-04-21

Last Passing Sequencing Read:

NNNCCCCGCATAGATTTTTTTTACTGATGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGAGGAGGAGGAGGGGGCGGTGGCCAAGGAGTGGGGCACGACCCCCGCGGGGCCCGTCTGGACCGCGGTGTTCGACTACGAGGCGGCGGGCGACGAGGAGCTGACCCTGCGGAGGGGCGATCGCGTCCAGGTGCTTTCCCAAGACTGTGCGGTGTCCGGCGACGAGGGCTGGTGGACCGGGCAGCTCCCCAGCGGCCGCGTGGGCGTCTTCCCCAGCAACTACGTGGCCCCCGGCGCCCCCGCTGCACCCGCGGGCCTCCAGCTGCCCCAGGAGATCCCCTTCCACGAGCTGCAGCTAGAGGAGATCATCGGTGTGGGGGGCTTTGGCAAGGTCTATCGGGCCCTGTGGCGTGGCGAGGAGGTGGCAGTCAAGGCCGCCCGGCTGGACCCTGAGAAGGACCCGGCAGTGACAGCGGAGCAGGTGTGCCAGGAAGCCCGGCTCTTTGGAGCCCTGCAGCACCCCAACATAATTGCCCTTAGGGGCGCCTGCCTCAACCCCCCACACCTCTGCCTAGTGATGGAGTATGCCCGGGGTGGTGCACTGAGCAGGGTGCTGGCAGGTCGCCGGGTGCCACCTCACGTGCTGGTCAACTGGGCTGTGCAGGTGGCCCGGGGCATGAACTACCTACACAATGATGCCCCTGTGCCCATCATCCACCGGGACCCTCAGTCCATCAACATCCTGATCCTGGAGGCCATCGAGAACCACAACCTCGCAGACACGGTGCTTCAGATCACGGACTTCGGCCTCGCCCGCGAGTGGGCACAGACCACCCAGATGAGCGCTGCGGGGACCTACGCCTGGATGGCGCCCGGAGTTATCCGTCTCTCCCTCTTCTCAAAAGCAGTGATGTCTGGACCTTCNGGGTGCTCCTGTGGGAGCTGCTGACGGGGGAAGTCCCCTACCGTGAGATCGACGCCTTGGCCTGGCGTATAGCTGGCTATTGATAACTGACGCTGCCATTCCTCCAGTGCCCCGACCCTTTCCCCCCTCCTGAAGAATGCTGGACCCAACCCCCCGGCGGCCGATTCGTAGCTTCTGAGCGGCTGGATTTTCAACGTCCGCCTGTCCAATGCCCTGAATCTCCCTCCTCTAGAACCGGACTGGAATCCCCAGTTATAACTCGACCAGAAAGACTCGACCTGAGGAATCTTCGGGCCGGAACCTTCCAAAAATTCCGGGGGAGGAGTGGAATATAAATTTGAAAGATTCCTCTTTTCTTCCAAAACCCCTCCAAGGATAACCCCTCCTTGAGAGACCACCCCTTTTATAAACCCCCTCTGAAAGAGAGGCCCCCCTCTCCCTCCTTCTTTNNNNNNTAATNNNNNNNNNNAAACCCGCCAAAGAAACTCCCCATCTTCCCGCATCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium