Clone: HsCD00082590

Clone ID:HsCD00082590
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC111586
Original Clone ID FLH267367.01X
HIP Master Clone ID 199496
IMAGE ID 40080547
HIP Clone ID 267367
GI 109939869

Property:

Collection: NIH_MGC_369
Collection: OCAB7
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2967 Homo sapiens CLOSED 1180 CLCN1 chloride channel 1, skeletal muscle (Thomsen disease, autosomal dominant)
Insert1
Size (bp)2967
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 1180
Gene SymbolCLCN1
Gene Namechloride channel 1, skeletal muscle (Thomsen disease, autosomal dominant)
Keyword

Insert Sequence:

ATGGAGCAATCCCGGTCACAGCAGCGTGGGGGTGAACAAAGCTGGTGGGGTAGTGACCCCCAGTACCAGTATATGCCCTTTGAACACTGCACCAGCTACGGACTGCCCTCTGAGAATGGGGGCCTCCAGCACAGGCTCCGGAAGGATGCAGGCCCCCGCCACAACGTCCACCCCACACAGATTTATGGCCATCACAAAGAACAATTCTCAGACAGGGAGCAGGACATAGGGATGCCCAAGAAGACAGGCTCCAGTTCTACCGTGGACAGCAAGGATGAGGATCACTATTCTAAATGTCAAGATTGTATCCACCGCCTGGGACAGGTGGTGAGAAGAAAATTAGGGGAAGACGGGATCTTTCTGGTGCTTCTGGGACTGCTGATGGCTCTGGTCAGCTGGAGCATGGACTACGTCAGTGCCAAAAGCCTTCAGGCCTACAAGTGGTCCTACGCGCAGATGCAGCCCAGCCTTCCTCTGCAGTTCCTGGTCTGGGTCACCTTCCCACTAGTCCTCATCCTCTTCAGCGCCCTCTTCTGCCACCTCATCTCTCCCCAGGCTGTTGGCTCTGGAATCCCCGAAATGAAGACAATACTTCGTGGGGTTGTCCTGAAGGAATACCTCACAATGAAAGCCTTTGTGGCCAAGGTTGTCGCCCTGACTGCGGGCCTGGGCAGTGGCATCCCCGTGGGGAAAGAGGGCCCCTTCGTCCACATTGCCAGCATCTGTGCTGCTGTCCTCAGCAAATTCATGTCTGTGTTCTGCGGGGTATATGAGCAGCCATACTACTACTCTGATATCCTGACGGTGGGCTGTGCTGTGGGAGTCGGCTGTTGTTTTGGGACACCACTTGGAGGAGTGCTATTTAGCATCGAGGTCACCTCCACCTACTTTGCTGTTCGGAACTACTGGAGAGGATTCTTTGCAGCCACGTTCAGCGCCTTTGTGTTTCGAGTGCTGGCAGTGTGGAACAAGGATGCTGTCACCATCACTGCTCTGTTCAGAACCAATTTCCGAATGGATTTCCCCTTTGACCTGAAGGAACTACCAGCTTTTGCTGCCATCGGGATTTGCTGTGGGCTCCTGGGAGCTGTATTTGTGTATCTGCATCGCCAAGTCATGCTCGGTGTCCGAAAGCACAAGGCCCTCAGCCAGTTTCTTGCTAAGCACCGCCTGCTGTATCCTGGAATTGTTACCTTTGTCATTGCCTCATTCACCTTCCCACCAGGAATGGGTCAATTCATGGCTGGAGAGTTGATGCCCCGCGAAGCCATCAGTACTTTGTTTGACAACAATACATGGGTGAAACACGCGGGTGATCCTGAGAGCCTGGGCCAGTCAGCTGTGTGGATTCACCCCCGGGTCAACGTTGTCATCATCATCTTTCTCTTCTTCGTCATGAAGTTCTGGATGTCCATCGTGGCCACCACTATGCCCATACCCTGCGGAGGCTTCATGCCTGTGTTTGTGCTAGGAGCTGCATTTGGAAGGCTGGTAGGAGAAATCATGGCCATGCTCTTTCCTGATGGTATTTTGTTTGATGACATCATCTACAAGATCCTACCTGGGGGCTATGCAGTAATTGGAGCAGCAGCGCTGACTGGTGCCGTTTCCCACACAGTCTCCACAGCTGTGATTTGCTTCGAATTAACGGGTCAGATTGCTCACATCCTGCCCATGATGGTGGCTGTTATCTTGGCCAACATGGTGGCCCAGAGCCTGCAGCCCTCTCTCTATGACAGCATCATCCAGGTCAAGAAGCTACCCTACTTGCCTGACCTTGGCTGGAACCAGCTCAGCAAATATACCATCTTTGTTGAGGACATCATGGTACGTGATGTGAAGTTTGTTTCAGCTTCTTACACATATGGGGAGTTGCGAACCCTGCTCCAGACCACCACAGTCAAGACTTTACCACTGGTTGACTCAAAAGATTCAATGATCCTGCTGGGCTCGGTGGAGCGGTCGGAACTGCAGGCCCTCCTGCAGCGCCACCTGTGTCCTGAGCGCAGGCTGCGCGCAGCCCAAGAGATGGCGCGGAAGTTGTCGGAGCTGCCTTACGACGGGAAGGCGCGGCTGGCTGGGGAGGGGCTCCCCGGCGCGCCTCCAGGCCGGCCCGAGTCCTTCGCCTTTGTGGATGAGGATGAGGACGAAGACCTCTCTGGCAAGAGCGAGCTTCCTCCTTCCCTTGCTCTCCACCCCTCTACTACTGCCCCTCTGTCCCCAGAAGAGCCCAATGGGCCTCTGCCTGGCCACAAACAGCAGCCGGAAGCACCAGAGCCTGCAGGTCAAAGACCCTCCATCTTCCAGTCCCTGCTTCACTGCTTGCTGGGCAGAGCTCGCCCCACAAAGAAGAAAACAACCCAGGATTCCACAGATTTAGTGGATAACATGTCACCTGAAGAGATTGAGGCCTGGGAGCAGGAGCAGCTGAGCCAGCCTGTCTGTTTTGATTCCTGCTGTATTGACCAGTCTCCCTTCCAGCTGGTGGAGCAGACAACCCTGCACAAGACTCATACCCTGTTTTCACTCCTTGGCCTCCACCTCGCTTACGTGACCAGCATGGGGAAGCTCAGGGGCGTCCTGGCCCTGGAGGAGCTACAGAAGGCCATTGAGGGGCACACCAAGTCTGGGGTGCAGCTCCGCCCTCCCCTTGCCAGCTTCCGGAACACGACTTCAACTCGAAAGAGTACCGGGGCACCTCCATCTTCTGCAGAGAACTGGAACCTGCCTGAGGACAGGCCTGGGGCCACTGGAACAGGGGATGTGATTGCTGCCTCCCCAGAGACCCCTGTGCCATCTCCTTCCCCAGAGCCCCCTCTCTCCCTGGCCCCAGGCAAGGTAGAGGGCGAGTTGGAGGAGCTGGAGCTGGTGGAGAGTCCAGGGCTGGAAGAGGAGCTGGCCGACATCTTGCAGGGCCCCAGCCTGCGATCCACAGACGAGGAGGATGAGGATGAACTGATCCTTTGA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 3001
Start on reference sequence 35

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTATGGAGCAATCCCGGTCACAGCAGCGTGGGGGTGAACAAAGCTGGTGGGGTAGTGACCCCCAGTACCAGTATATGCCCTTTGAACACTGCACCAGCTACGGACTGCCCTCTGAGAATGGGGGCCTCCAGCACAGGCTCCGGAAGGATGCAGGCCCCCGCCACAACGTCCACCCCACACAGATTTATGGCCATCACAAAGAACAATTCTCAGACAGGGAGCAGGACATAGGGATGCCCAAGAAGACAGGCTCCAGTTCTACCGTGGACAGCAAGGATGAGGATCACTATTCTAAATGTCAAGATTGTATCCACCGCCTGGGACAGGTGGTGAGAAGAAAATTAGGGGAAGACGGGATCTTTCTGGTGCTTCTGGGACTGCTGATGGCTCTGGTCAGCTGGAGCATGGACTACGTCAGTGCCAAAAGCCTTCAGGCCTACAAGTGGTCCTACGCGCAGATGCAGCCCAGCCTTCCTCTGCAGTTCCTGGTCTGGGTCACCTTCCCACTAGTCCTCATCCTCTTCAGCGCCCTCTTCTGCCACCTCATCTCTCCCCAGGCTGTTGGCTCTGGAATCCCCGAAATGAAGACAATACTTCGTGGGGTTGTCCTGAAGGAATACCTCACAATGAAAGCCTTTGTGGCCAAGGTTGTCGCCCTGACTGCGGGCCTGGGCAGTGGCATCCCCGTGGGGAAAGAGGGCCCCTTCGTCCACATTGCCAGCATCTGTGCTGCTGTCCTCAGCAAATTCATGTCTGTGTTCTGCGGGGTATATGAGCAGCCATACTACTACTCTGATATCCTGACGGTGGGCTGTGCTGTGGGAGTCGGCTGTTGTTTTGGGACACCACTTGGAGGAGTGCTATTTAGCATCGAGGTCACCTCCACCTACTTTGCTGTTCGGAACTACTGGAGAGGATTCTTTGCAGCCACGTTCAGCGCCTTTGTGTTTCGAGTGCTGGCAGTGTGGAACAAGGATGCTGTCACCATCACTGCTCTGTTCAGAACCAATTTCCGAATGGATTTCCCCTTTGACCTGAAGGAACTACCAGCTTTTGCTGCCATCGGGATTTGCTGTGGGCTCCTGGGAGCTGTATTTGTGTATCTGCATCGCCAAGTCATGCTCGGTGTCCGAAAGCACAAGGCCCTCAGCCAGTTTCTTGCTAAGCACCGCCTGCTGTATCCTGGAATTGTTACCTTTGTCATTGCCTCATTCACCTTCCCACCAGGAATGGGTCAATTCATGGCTGGAGAGTTGATGCCCCGCGAAGCCATCAGTACTTTGTTTGACAACAATACATGGGTGAAACACGCGGGTGATCCTGAGAGCCTGGGCCAGTCAGCTGTGTGGATTCACCCCCGGGTCAACGTTGTCATCATCATCTTTCTCTTCTTCGTCATGAAGTTCTGGATGTCCATCGTGGCCACCACTATGCCCATACCCTGCGGAGGCTTCATGCCTGTGTTTGTGCTAGGAGCTGCATTTGGAAGGCTGGTAGGAGAAATCATGGCCATGCTCTTTCCTGATGGTATTTTGTTTGATGACATCATCTACAAGATCCTACCTGGGGGCTATGCAGTAATTGGAGCAGCAGCGCTGACTGGTGCCGTTTCCCACACAGTCTCCACAGCTGTGATTTGCTTCGAATTAACGGGTCAGATTGCTCACATCCTGCCCATGATGGTGGCTGTTATCTTGGCCAACATGGTGGCCCAGAGCCTGCAGCCCTCTCTCTATGACAGCATCATCCAGGTCAAGAAGCTACCCTACTTGCCTGACCTTGGCTGGAACCAGCTCAGCAAATATACCATCTTTGTTGAGGACATCATGGTACGTGATGTGAAGTTTGTTTCAGCTTCTTACACATATGGGGAGTTGCGAACCCTGCTCCAGACCACCACAGTCAAGACTTTACCACTGGTTGACTCAAAAGATTCAATGATCCTGCTGGGCTCGGTGGAGCGGTCGGAACTGCAGGCCCTCCTGCAGCGCCACCTGTGTCCTGAGCGCAGGCTGCGCGCAGCCCAAGAGATGGCGCGGAAGTTGTCGGAGCTGCCTTACGACGGGAAGGCGCGGCTGGCTGGGGAGGGGCTCCCCGGCGCGCCTCCAGGCCGGCCCGAGTCCTTCGCCTTTGTGGATGAGGATGAGGACGAAGACCTCTCTGGCAAGAGCGAGCTTCCTCCTTCCCTTGCTCTCCACCCCTCTACTACTGCCCCTCTGTCCCCAGAAGAGCCCAATGGGCCTCTGCCTGGCCACAAACAGCAGCCGGAAGCACCAGAGCCTGCAGGTCAAAGACCCTCCATCTTCCAGTCCCTGCTTCACTGCTTGCTGGGCAGAGCTCGCCCCACAAAGAAGAAAACAACCCAGGATTCCACAGATTTAGTGGATAACATGTCACCTGAAGAGATTGAGGCCTGGGAGCAGGAGCAGCTGAGCCAGCCTGTCTGTTTTGATTCCTGCTGTATTGACCAGTCTCCCTTCCAGCTGGTGGAGCAGACAACCCTGCACAAGACTCATACCCTGTTTTCACTCCTTGGCCTCCACCTCGCTTACGTGACCAGCATGGGGAAGCTCAGGGGCGTCCTGGCCCTGGAGGAGCTACAGAAGGCCATTGAGGGGCACACCAAGTCTGGGGTGCAGCTCCGCCCTCCCCTTGCCAGCTTCCGGAACACGACTTCAACTCGAAAGAGTACCGGGGCACCTCCATCTTCTGCAGAGAACTGGAACCTGCCTGAGGACAGGCCTGGGGCCACTGGAACAGGGGATGTGATTGCTGCCTCCCCAGAGACCCCTGTGCCATCTCCTTCCCCAGAGCCCCCTCTCTCCCTGGCCCCAGGCAAGGTAGAGGGCGAGTTGGAGGAGCTGGAGCTGGTGGAGAGTCCAGGGCTGGAAGAGGAGCTGGCCGACATCTTGCAGGGCCCCAGCCTGCGATCCACAGACGAGGAGGATGAGGATGAACTGATCCTTTGATACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG

Sequencing Information:

Phred Score: 892
Date: 2015-08-03

Last Passing Sequencing Read:

NTTTAACGCATAGATTTATTTTACTGAAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGGAGCAATCCCGGTCACAGCAGCGTGGGGGTGAACAAAGCTGGTGGGGTAGTGACCCCCAGTACCAGTATATGCCCTTTGAACACTGCACCAGCTACGGACTGCCCTCTGAGAATGGGGGCCTCCAGCACAGGCTCCGGAAGGATGCAGGCCCCCGCCACAACGTCCACCCCACACAGATTTATGGCCATCACAAAGAACAATTCTCAGACAGGGAGCAGGACATAGGGATGCCCAAGAAGACAGGCTCCAGTTCTACCGTGGACAGCAAGGATGAGGATCACTATTCTAAATGTCAAGATTGTATCCACCGCCTGGGACAGGTGGTGAGAAGAAAATTAGGGGAAGACGGGATCTTTCTGGTGCTTCTGGGACTGCTGATGGCTCTGGTCAGCTGGAGCATGGACTACGTCAGTGCCAAAAGCCTTCAGGCCTACAAGTGGTCCTACGCGCAGATGCAGCCCAGCCTTCCTCTGCAGTTCCTGGTCTGGGTCACCTTCCCACTAGTCCTCATCCTCTTCAGCGCCCTCTTCTGCCACCTCATCTCTCCCCAGGCTGTTGGCTCTGGAATCCCCGAAATGAAGACAATACTTCGTGGGGTTGTCCTGAAGGAATACCTCACAATGAAAGCCTTTGTGGCCAAGGTTGTCGCCCTGACTGCGGGCCTGGGCAGTGGCATCCCCGTGGGGAAAGAGGGCCCCTTCGTCCACATTGCCAGCATCTGTGCTGCTGTCCTCAGCAAATTCATGTCTGTGTTCTGCGGGGTATATGAGCAGCCATACTACTACTCTGATATCCTGACGGTGGGCTGTGCTGTGGGAGTCGGCTGTTGTTTTGGGACACCACTTGGAGGAGTGCTNATTAGCATCGAGGTCACCTCCACCTACTTTGCTGNTCGGACTACTGNAGAGGATTCTTGCAGCCACGTCAGCGCCTTTGTGTTTAAGTGCTGGAATTGTGGAACAAGATGCTGTCCCCATCCTGCTCTGGTCAAAACCAATTTCGAAGGATTCCCCCTTGACCTGAAGGACTACAACCTTTGCCCCATCGGGATGGCTGTGGGTCCTGGGGCTGTTTTTGGTTTTGCTCCCCAATTATGCCGGGGCCAAAACAAAGGCTTCACCATTTTTGTAAACACCCCGCGGATCCGAATTGACCTTGCTTGCCCCTCCCTTCCCCAGAAAGGCATTCTGGTGGAAGTGTGGCCCGAACCCTAAATTTTTAAACAAATGGGAAACACCGGGACCTAAGCTGGACCATTGTGTTTCCCCGGAACATTTCCATCTTTCTTCCAAAATGGAGACAGGCCCCAACCACCGGGATTCTTGTTTAAAACTTGAGGAAGAAAACCTCTTGATTTTTAAACAACCGGGTATAAGAA

Vector Information:

Vector Name:pENTR223.1
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml.
Map:pENTR223-1-map.doc
Sequence:pENTR223_1.txt
Size (bp):4311
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium