Clone: HsCD00082329

Clone ID:HsCD00082329
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GI 117644503
GenBank Accession AM392869
IMAGE ID 100002217
Original Clone ID FLH266953.01L
HIP Master Clone ID 199051
HIP Clone ID 266953

Property:

Collection: DKFZo001
Collection: OCAA6
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 2331 Homo sapiens FUSION 54893 MTMR10 myotubularin related protein 10
Insert1
Size (bp)2331
SpeciesHomo sapiens
FormatFUSION
Tissue Source
Species Specific ID 54893
Gene SymbolMTMR10
Gene Namemyotubularin related protein 10
Keyword

Insert Sequence:

ATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAACAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGGTATGCCTTGCAATAGCTCATTATTCCCAGCCAACAGACCTCCAGCTACTCTTTGCATTTGAATATGTTGGGAAAAAATACCACAATTCAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAATACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACGCCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGGGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGAC

Insert Property: Insert 1

Type Value Extra Information
Discrepancy g318a; g1024a,V342I; a1686g; a2129g,E710G
End on reference sequence 2432
Start on reference sequence 99

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCTGGCACCATGTTCTCCCTCAAGCCGCCCAAACCCACCTTCAGGTCCTACCTCCTGCCACCGCCCCAGACTGACGATAAGATCAATTCGGAACCGAAGATTAAAAAACTGGAGCCAGTCCTTTTGCCAGGAGAAATTGTCGTAAATGAAGTCAATTTTGTGAGAAAATGCATTGCAACAGACACAAGCCAGTACGATTTGTGGGGAAAGCTGATATGCAGTAACTTCAAAATCTCCTTTATTACAGATGACCCAATGCCATTACAGAAATTCCATTACAGAAACCTTCTTCTTGGTGAACACGATGTCCCTTTAACATGTATTGAACAAATTGTCACAGTAAACGACCACAAGAGGAAGCAGAAAGTCCTAGGCCCCAACCAGAAACTGAAATTTAATCCAACAGAGTTAATTATTTATTGTAAAGATTTCAGAATTGTCAGATTTCGCTTTGATGAATCAGGTCCCGAAAGTGCTAAAAAGGTATGCCTTGCAATAGCTCATTATTCCCAGCCAACAGACCTCCAGCTACTCTTTGCATTTGAATATGTTGGGAAAAAATACCACAATTCAGCAAACAAAATTAATGGAATTCCCTCAGGAGATGGAGGAGGAGGAGGAGGAGGAGGTAATGGAGCTGGTGGTGGCAGCAGCCAGAAAACTCCACTCTTTGAAACTTACTCGGATTGGGACAGAGAAATCAAGAGGACAGGTGCTTCCGGGTGGAGAGTTTGTTCTATTAACGAGGGTTACATGATATCCACTTGCCTTCCAGAATACATTGTAGTGCCAAGTTCTTTAGCAGACCAAGATCTAAAGATCTTTTCCCATTCTTTTGTTGGGAGAAGGATGCCACTCTGGTGCTGGAGCCACTCTAACGGCAGTGCTCTTGTGCGAATGGCCCTCATCAAAGACGTGCTGCAGCAGAGGAAGATTGACCAGAGGATTTGTAATGCAATAACTAAAAGTCACCCACAGAGAAGTGATGTTTACAAATCAGATTTGGATAAGACCTTGCCTAATATTCAAGAAATACAGGCAGCATTTGTAAAACTGAAGCAGCTATGCGTTAATGAGCCTTTTGAAGAAACTGAAGAGAAATGGTTATCTTCACTGGAAAATACTCGATGGTTAGAATATGTAAGGGCATTCCTTAAGCATTCAGCAGAACTTGTATACATGCTAGAAAGCAAACATCTCTCTGTAGTCCTACAAGAGGAGGAAGGAAGAGACTTGAGCTGTTGTGTAGCTTCTCTTGTTCAAGTGATGCTGGATCCCTATTTTAGGACAATTACTGGATTTCAGAGTCTGATACAGAAGGAGTGGGTCATGGCAGGATATCAGTTTCTAGACAGATGCAACCATCTAAAGAGATCAGAGAAAGAGTCTCCTTTATTTTTGCTATTCTTGGATGCCACCTGGCAGCTGTTAGAACAATATCCTGCAGCTTTTGAGTTCTCCGAAACCTACCTGGCAGTGTTGTATGACAGCACCCGGATCTCACTGTTTGGCACCTTCCTGTTCAACTCCCCTCACCAGCGAGTGAAGCAAAGCACGGAATTTGCTATAAGCAAAAACATCCAATTGGGTGATGAGAAGGGCTTAAAATTCCCCTCTGTTTGGGACTGGTCTCTCCAGTTTACAGCAAAGGATCGCACCCTTTTCCATAACCCCTTCTACATTGGAAAGAGCACGCCTTGTATACAGAATGGCTCCGTGAAGTCTTTTAAACGGACAAAGAAAAGCTACAGCTCCACACTAAGAGGAATGCCGTCTGCCTTAAAGAATGGAATCATCAGTGACCAAGAATTACTTCCAAGGAGAAATTCATTGATATTAAAACCAAAGCCAGATCCAGCTCAGCAAACCGACAGCCAGAACAGTGATACGGAGCAGTATTTTAGAGAATGGTTTTCCAAACCCGCCAACCTGCACGGTGTTATTCTGCCACGTGTCTCTGGAACACACATAAAACTGTGGAAACTGTGCTACTTCCGCTGGGTTCCCGAGGCCCAGATCAGCCTGGGTGGCTCCATCACAGCCTTTCACAAGCTCTCCCTCCTGGCTGATGAAGTCGACGTACTGAGCAGGATGCTGCGGCAACAGCGCAGTGGCCCCCTGGAGGCCTGCTATGGGGGGCTGGGCCAGAGCAGGATGTACTTCAACGCCAGCGGCCCTCACCACACCGACACCTCGGGGACACCGGAGTTTCTCTCCTCCTCATTTCCATTTTCTCCTGTAGGGAATCTGTGCAGACGAAGCATTTTAGGAACACCATTAAGCAAATTTTTAAGTGGGGCCAAAATATGGTTGTCTACTGAGACATTAGCAAATGAAGACGGCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pDONR201
Type:bacterial plasmid
Description:Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr201_pdonr207_map.pdf
Sequence:pDONR201_FASTA.txt
Size (bp):4470
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium