Clone: EvNO00079526 ← Click Here To Order

Clone ID:EvNO00079526
Is Verified:U
Status:AVAILABLE
Source:HIP
Description:Empty vector that adds EGFP fusion to insert (discontinued by supplier); kan resistance; Creator (Cre/Lox-type) recombinational cloning.
Comments:Vector discontinued by original supplier; helpful as control for with-insert constructs in the repository collection.
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:
Map:

Related Identifiers:

Original Clone ID pLP-EGFP-C1

Sequencing Information:

Phred Score: 0
Date: 2013-02-13

Last Passing Sequencing Read:

CGNTGNNNATNAGCANACTNGGTTTNGTTGAACCGNTCAGATCCGCTAGGCGCTACCGGNTCGCCACCATGGTGAGCAAG GGCGNGGNGCTTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGT CCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCC TGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTT CTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCG CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATC CTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGT GAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCG ACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGAT CACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATC TCGAGCTCAAGCTTCGATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATTTTTTTNAANNNNNTTTTTTN CGGGNTTTTTNNTTTNATGANNNGNATANNTTTTTNAANTGTNTTTANAAAAATAAACAAATAGGGGTTCCNCNCAATTT CCCCAAAAANNGCCNCCTGANNTGGATCCNCCGGATNTANATAACTGATNNTAATCNNCNTACNNNTTTGTAAAGGTTTT ACTTGNTTNAAAANCTNCCNNACTNCCCCTGAACTNAANNTAAANGANGNATTGTNNTNNTAANTGTTNTGNNNTTNNAN GNTNNAANANNNANNNNTNNNANTTNNNANAANNNTTTTTNNNNNTNNNNTNGNTTNNNANNNNNNNNNNTTANNNNNNT TNNNNNNNNTTTNNNAANNNNNNNATTTTNNNNNNNNNNTTTNNNNNNNNNNNNNNNNNNNNTTNNNNNNNNNNNNNNNN NNNNNNNTTNNNTNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pLP-EGFP-C1
Type:bacterial plasmid
Description:Mammalian expression vector with CMV promoter, EGFP tag; kanamycin resistance (neomycin for mammalian selection); recombinational cloning.
Properties:Creator, acceptor (destination), fluorescent marker, mammalian expression, ssDNA production, with tag/fusion/marker
Comments:
Map:pLP-EGFP-C1.pdf
Sequence:pLP-EGFP-C1.txt
Size (bp):4900
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Phage-resistant DH5-alpha Y From HIP lab

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
BD Biosciences Clontech Adademic researcher, clone donor and PI