Clone: HsCD00076062

Clone ID:HsCD00076062
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH179552.01X
HIP Clone ID 179552
HIP Master Clone ID 154653

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 3285 Homo sapiens CLOSED MGC template 8546 AP3B1 adaptor-related protein complex 3, beta 1 subunit
Insert1
Size (bp)3285
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceMGC template
Species Specific ID 8546
Gene SymbolAP3B1
Gene Nameadaptor-related protein complex 3, beta 1 subunit
Keyword

Insert Sequence:

ATGTCCAGCAATAGTTTTCCTTACAATGAGCAGTCCGGAGGAGGGGAGGCGACGGAGCTGGGTCAGGAGGCGACCTCAACCATTTCCCCCTCGGGGGCCTTCGGCCTCTTTAGCAGCGATTTGAAGAAGAATGAAGATCTAAAGCAAATGTTAGAGAGCAACAAAGATTCTGCTAAACTGGATGCTATGAAGCGGATTGTTGGGATGATTGCAAAAGGGAAAAATGCATCTGAACTGTTTCCTGCTGTTGTGAAGAATGTGGCCAGTAAAAATATTGAGATCAAGAAGTTGGTATATGTTTACCTGGTTCGATATGCTGAAGAACAGCAGGATCTTGCACTCCTGTCCATAAGCACTTTTCAGCGAGCTCTGAAGGACCCAAACCAACTAATTCGTGCAAGCGCTTTGAGAGTTCTGTCAAGTATTAGAGTGCCAATTATTGTACCTATCATGATGCTTGCTATTAAGGAAGCTTCTGCTGACTTATCACCATATGTTAGGAAGAATGCAGCCCATGCAATACAAAAATTATACAGCCTTGATCCAGAGCAGAAGGAAATGTTAATTGAAGTAATTGAAAAACTTCTGAAAGATAAAAGCACATTGGTAGCTGGCAGTGTTGTGATGGCTTTTGAAGAAGTATGCCCGGACAGAATAGATCTGATTCATAAAAATTACCGCAAGCTATGTAACTTACTAGTGGATGTTGAAGAGTGGGGGCAGGTTGTCATAATCCACATGCTAACTCGATATGCTCGGACACAGTTTGTCAGCCCTTGGAAAGAGGGTGATGAATTAGAAGACAATGGAAAGAATTTCTACGAATCTGATGATGATCAGAAGGAAAAGACTGACAAAAAGAAGAAGCCGTATACTATGGATCCAGATCATAGACTCTTAATTAGAAATACAAAGCCTTTGCTTCAGAGCAGGAATGCTGCGGTGGTTATGGCAGTTGCTCAGCTGTATTGGCACATATCACCAAAATCTGAAGCTGGCATAATTTCTAAATCACTAGTGCGTTTACTTCGTAGCAATAGGGAGGTGCAGTATATTGTCCTACAAAATATAGCAACTATGTCAATTCAAAGAAAGGGGATGTTTGAACCTTATCTGAAGAGTTTCTATGTTAGGTCAACTGATCCAACTATGATCAAGACACTGAAGCTTGAAATTTTGACAAACTTGGCAAATGAAGCCAACATATCAACTCTTCTTCGAGAATTTCAGACCTATGTGAAAAGCCAGGATAAACAATTTGCAGCAGCCACTATTCAGACTATAGGCAGATGTGCAACCAACATCTTGGAAGTCACTGACACGTGCCTCAATGGCTTGGTCTGTCTGCTGTCCAACAGGGATGAAATAGTTGTTGCTGAAAGTGTGGTTGTTATAAAGAAATTACTGCAAATGCAACCTGCACAACATGGTGAAATTATTAAACATATGGCCAAACTCCTGGACAGTATCACTGTTCCTGTTGCTAGAGCAAGTATTCTTTGGCTAATTGGAGAAAACTGTGAACGAGTTCCTAAAATTGCCCCTGATGTTTTGAGGAAGATGGCTAAAAGCTTCACTAGTGAAGATGATCTGGTAAAACTGCAGATATTAAATCTGGGAGCAAAATTGTATTTAACCAACTCCAAACAGACAAAATTGCTTACCCAGTACATATTAAATCTCGGCAAGTATGATCAAAACTACGACATCAGAGACCGTACAAGATTTATTAGGCAGCTTATTGTTCCGAATGAAAAGAGTGGAGCTTTAAGTAAATATGCCAAAAAAATATTCCTAGCACAAAAGCCTGCACCACTGCTTGAGTCTCCTTTTAAAGATAGAGATCATTTCCAGCTTGGCACCTTATCTCATACTCTCAACATTAAAGCTACTGGGTACCTGGAATTATCTAATTGGCCAGAGGTGGCGCCCGACCCATCAGTTCGAAATGTAGAAGTAATAGAGTTGGCAAAAGAATGGACCCCAGCAGGAAAAGCAAAGCAAGAGAATTCTGCTAAGAAGTTTTATTCTGAATCTGAGGAAGAGGAGGACTCTTCTGATAGTAGCAGTGACAGTGAGAGTGAATCTGGAAGTGAAAGTGGAGAACAAGGCGAAAGTGGGGAGGAAGGAGACAGCAATGAGGACAGCAGTGAGGACTCCTCCAGTGAGCAGGACAGTGAGAGTGGACGGGAGTCAGGCCTAGAAAACAAAAGAACAGCCAAGAGGAACTCAAAAGCCAAAGGAAAAAGTGATTCTGAAGATGGGGAGAAGGAAAATGAAAAATCTAAAACTTCAGATTCTTCAAATGACGAATCTAGTTCAATAGAAGACAGTTCTTCCGATTCTGAATCAGAGTCAGAACCTGAAAGTGAATCTGAATCCAGAAGAGTCACTAAGGAGAAAGAAAAGAAAACAAAGCAAGATAGAACTCCTCTTACCAAAGATGTTTCACTTCTAGATCTGGATGATTTTAACCCAGTATCCACTCCAGTTGCACTTCCCACACCAGCTCTTTCTCCAAGTTTGATGGCTGATCTTGAAGGTTTACACTTGTCAACTTCCTCTTCAGTCATCAGTGTCAGTACTCCTGCATTTGTACCAACGAAAACTCACGTGCTGCTTCATCGAATGAGTGGAAAAGGACTAGCTGCCCATTATTTCTTTCCAAGACAGCCTTGCATTTTTGGTGATAAGATGGTCTCTATACAAATAACACTGAATAACACTACTGATCGAAAGATAGAAAATATCCACATAGGGGAAAAAAAACTTCCTATAGGCATGAAAATGCATGTTTTTAATCCAATAGACTCTCTTGAGCCTGAGGGATCCATTACAGTTTCAATGGGTATTGACTTTTGTGATTCTACTCAGACTGCCAGTTTCCAGTTGTGTACCAAGGATGATTGCTTCAATGTTAATATTCAGCCACCTGTTGGAGAACTGCTTTTACCTGTGGCCATGTCAGAGAAAGATTTTAAGAAAGAGCAAGGAGTGCTAACAGGAATGAATGAAACTTCTGCTGTAATCATTGCTGCACCACAGAATTTCACTCCCTCTGTGATCTTTCAGAAGGTTGTAAATGTAGCCAATGTAGGTGCAGTCCCTTCTGGCCAGGATAATATACACAGGTTTGCAGCTAAAACTGTGCACAGTGGGTCATTGATGCTAGTCACAGTGGAACTGAAGGAAGGCTCTACAGCCCAGCTTATCATAAACACTGAGAAAACTGTGATTGGCTCTGTTCTGCTGCGGGAACTGAAGCCTGTCCTGTCTCAGGGGTAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 3422
Start on reference sequence 138

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTATGTCCAGCAATAGTTTTCCTTACAATGAGCAGTCCGGAGGAGGGGAGGCGACGGAGCTGGGTCAGGAGGCGACCTCAACCATTTCCCCCTCGGGGGCCTTCGGCCTCTTTAGCAGCGATTTGAAGAAGAATGAAGATCTAAAGCAAATGTTAGAGAGCAACAAAGATTCTGCTAAACTGGATGCTATGAAGCGGATTGTTGGGATGATTGCAAAAGGGAAAAATGCATCTGAACTGTTTCCTGCTGTTGTGAAGAATGTGGCCAGTAAAAATATTGAGATCAAGAAGTTGGTATATGTTTACCTGGTTCGATATGCTGAAGAACAGCAGGATCTTGCACTCCTGTCCATAAGCACTTTTCAGCGAGCTCTGAAGGACCCAAACCAACTAATTCGTGCAAGCGCTTTGAGAGTTCTGTCAAGTATTAGAGTGCCAATTATTGTACCTATCATGATGCTTGCTATTAAGGAAGCTTCTGCTGACTTATCACCATATGTTAGGAAGAATGCAGCCCATGCAATACAAAAATTATACAGCCTTGATCCAGAGCAGAAGGAAATGTTAATTGAAGTAATTGAAAAACTTCTGAAAGATAAAAGCACATTGGTAGCTGGCAGTGTTGTGATGGCTTTTGAAGAAGTATGCCCGGACAGAATAGATCTGATTCATAAAAATTACCGCAAGCTATGTAACTTACTAGTGGATGTTGAAGAGTGGGGGCAGGTTGTCATAATCCACATGCTAACTCGATATGCTCGGACACAGTTTGTCAGCCCTTGGAAAGAGGGTGATGAATTAGAAGACAATGGAAAGAATTTCTACGAATCTGATGATGATCAGAAGGAAAAGACTGACAAAAAGAAGAAGCCGTATACTATGGATCCAGATCATAGACTCTTAATTAGAAATACAAAGCCTTTGCTTCAGAGCAGGAATGCTGCGGTGGTTATGGCAGTTGCTCAGCTGTATTGGCACATATCACCAAAATCTGAAGCTGGCATAATTTCTAAATCACTAGTGCGTTTACTTCGTAGCAATAGGGAGGTGCAGTATATTGTCCTACAAAATATAGCAACTATGTCAATTCAAAGAAAGGGGATGTTTGAACCTTATCTGAAGAGTTTCTATGTTAGGTCAACTGATCCAACTATGATCAAGACACTGAAGCTTGAAATTTTGACAAACTTGGCAAATGAAGCCAACATATCAACTCTTCTTCGAGAATTTCAGACCTATGTGAAAAGCCAGGATAAACAATTTGCAGCAGCCACTATTCAGACTATAGGCAGATGTGCAACCAACATCTTGGAAGTCACTGACACGTGCCTCAATGGCTTGGTCTGTCTGCTGTCCAACAGGGATGAAATAGTTGTTGCTGAAAGTGTGGTTGTTATAAAGAAATTACTGCAAATGCAACCTGCACAACATGGTGAAATTATTAAACATATGGCCAAACTCCTGGACAGTATCACTGTTCCTGTTGCTAGAGCAAGTATTCTTTGGCTAATTGGAGAAAACTGTGAACGAGTTCCTAAAATTGCCCCTGATGTTTTGAGGAAGATGGCTAAAAGCTTCACTAGTGAAGATGATCTGGTAAAACTGCAGATATTAAATCTGGGAGCAAAATTGTATTTAACCAACTCCAAACAGACAAAATTGCTTACCCAGTACATATTAAATCTCGGCAAGTATGATCAAAACTACGACATCAGAGACCGTACAAGATTTATTAGGCAGCTTATTGTTCCGAATGAAAAGAGTGGAGCTTTAAGTAAATATGCCAAAAAAATATTCCTAGCACAAAAGCCTGCACCACTGCTTGAGTCTCCTTTTAAAGATAGAGATCATTTCCAGCTTGGCACCTTATCTCATACTCTCAACATTAAAGCTACTGGGTACCTGGAATTATCTAATTGGCCAGAGGTGGCGCCCGACCCATCAGTTCGAAATGTAGAAGTAATAGAGTTGGCAAAAGAATGGACCCCAGCAGGAAAAGCAAAGCAAGAGAATTCTGCTAAGAAGTTTTATTCTGAATCTGAGGAAGAGGAGGACTCTTCTGATAGTAGCAGTGACAGTGAGAGTGAATCTGGAAGTGAAAGTGGAGAACAAGGCGAAAGTGGGGAGGAAGGAGACAGCAATGAGGACAGCAGTGAGGACTCCTCCAGTGAGCAGGACAGTGAGAGTGGACGGGAGTCAGGCCTAGAAAACAAAAGAACAGCCAAGAGGAACTCAAAAGCCAAAGGAAAAAGTGATTCTGAAGATGGGGAGAAGGAAAATGAAAAATCTAAAACTTCAGATTCTTCAAATGACGAATCTAGTTCAATAGAAGACAGTTCTTCCGATTCTGAATCAGAGTCAGAACCTGAAAGTGAATCTGAATCCAGAAGAGTCACTAAGGAGAAAGAAAAGAAAACAAAGCAAGATAGAACTCCTCTTACCAAAGATGTTTCACTTCTAGATCTGGATGATTTTAACCCAGTATCCACTCCAGTTGCACTTCCCACACCAGCTCTTTCTCCAAGTTTGATGGCTGATCTTGAAGGTTTACACTTGTCAACTTCCTCTTCAGTCATCAGTGTCAGTACTCCTGCATTTGTACCAACGAAAACTCACGTGCTGCTTCATCGAATGAGTGGAAAAGGACTAGCTGCCCATTATTTCTTTCCAAGACAGCCTTGCATTTTTGGTGATAAGATGGTCTCTATACAAATAACACTGAATAACACTACTGATCGAAAGATAGAAAATATCCACATAGGGGAAAAAAAACTTCCTATAGGCATGAAAATGCATGTTTTTAATCCAATAGACTCTCTTGAGCCTGAGGGATCCATTACAGTTTCAATGGGTATTGACTTTTGTGATTCTACTCAGACTGCCAGTTTCCAGTTGTGTACCAAGGATGATTGCTTCAATGTTAATATTCAGCCACCTGTTGGAGAACTGCTTTTACCTGTGGCCATGTCAGAGAAAGATTTTAAGAAAGAGCAAGGAGTGCTAACAGGAATGAATGAAACTTCTGCTGTAATCATTGCTGCACCACAGAATTTCACTCCCTCTGTGATCTTTCAGAAGGTTGTAAATGTAGCCAATGTAGGTGCAGTCCCTTCTGGCCAGGATAATATACACAGGTTTGCAGCTAAAACTGTGCACAGTGGGTCATTGATGCTAGTCACAGTGGAACTGAAGGAAGGCTCTACAGCCCAGCTTATCATAAACACTGAGAAAACTGTGATTGGCTCTGTTCTGCTGCGGGAACTGAAGCCTGTCCTGTCTCAGGGGTAGAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute