Clone: HsCD00073900

Clone ID:HsCD00073900
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 257942
HIP Master Clone ID 194558
Original Clone ID FLH257942.01X
GenBank Accession CU013073
GI 109451285
IMAGE ID 100000331

Property:

Collection: OCAB4
Collection: The ORFeome Collaboration
Collection: WTSI-chORF

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 918 Homo sapiens CLOSED 55670 PEX26 peroxisome biogenesis factor 26
Insert1
Size (bp)918
SpeciesHomo sapiens
FormatCLOSED
Tissue Source
Species Specific ID 55670
Gene SymbolPEX26
Gene Nameperoxisome biogenesis factor 26
Keyword

Insert Sequence:

ATGAAGAGCGATTCTTCGACCTCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGCGCAGCAGCGAGCCGGTGCGCGCGGTCCCGGCCCGGGCGCCGGCCGTGGACCTTCTGGAGGAGGCGGCCGACCTCCTGGTGGTGCACCTGGACTTCCGGGCGGCGCTGGAGACCTGCGAGCGGGCCTGGCAGAGTCTGGCCAACCACGCCGTGGCAGAGGAACCCGCGGGCACCTCATTGGAGGTGAAGTGCTCCCTGTGTGTTGTGGGGATCCAGGCCCTGGCAGAAATGGATCGGTGGCAAGAAGTCCTCTCCTGGGTCCTTCAGTATTACCAGGTCCCTGAAAAGCTACCCCCCAAAGTCCTGGAGCTGTGCATTCTTTTATACAGCAAAATGCAAGAGCCTGGAGCTGTGCTGGATGTGGTGGGTGCCTGGCTCCAAGACCCAGCCAATCAAAACCTTCCAGAATATGGAGCCTTGGCAGAATTTCACGTGCAGCGGGTGCTGCTGCCTCTGGGCTGCTTATCGGAGGCTGAGGAGCTAGTGGTGGGCTCTGCAGCCTTTGGTGAGGAGCGGCGACTGGATGTACTTCAGGCCATTCACACAGCGAGGCAGCAGCAGAAACAGGAACACTCAGGCTCTGAGGAGGCCCAGAAGCCAAACCTGGAAGGCTCTGTCTCCCACAAGTTCCTGTCACTACCGATGTTGGTTCGCCAGCTTTGGGACTCTGCGGTGAGCCACTTCTTTTCTCTGCCCTTCAAAAAGAGTCTCCTGGCTGCCTTGATCCTCTGTCTCCTGGTGGTGAGATTTGATCCAGCTTCCCCTTCCTCCCTGCACTTCCTCTACAAGCTGGCCCAGCTCTTCCGCTGGATCCGGAAGGCTGCATTTTCTCGCCTCTACCAGCTCCGCATCCGTGACTGA

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 936
Start on reference sequence 19

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAGCGATTCTTCGACCTCTGCAGCCCCCCTCAGGGGGCTCGGGGGACCCCTGCGCAGCAGCGAGCCGGTGCGCGCGGTCCCGGCCCGGGCGCCGGCCGTGGACCTTCTGGAGGAGGCGGCCGACCTCCTGGTGGTGCACCTGGACTTCCGGGCGGCGCTGGAGACCTGCGAGCGGGCCTGGCAGAGTCTGGCCAACCACGCCGTGGCAGAGGAACCCGCGGGCACCTCATTGGAGGTGAAGTGCTCCCTGTGTGTTGTGGGGATCCAGGCCCTGGCAGAAATGGATCGGTGGCAAGAAGTCCTCTCCTGGGTCCTTCAGTATTACCAGGTCCCTGAAAAGCTACCCCCCAAAGTCCTGGAGCTGTGCATTCTTTTATACAGCAAAATGCAAGAGCCTGGAGCTGTGCTGGATGTGGTGGGTGCCTGGCTCCAAGACCCAGCCAATCAAAACCTTCCAGAATATGGAGCCTTGGCAGAATTTCACGTGCAGCGGGTGCTGCTGCCTCTGGGCTGCTTATCGGAGGCTGAGGAGCTAGTGGTGGGCTCTGCAGCCTTTGGTGAGGAGCGGCGACTGGATGTACTTCAGGCCATTCACACAGCGAGGCAGCAGCAGAAACAGGAACACTCAGGCTCTGAGGAGGCCCAGAAGCCAAACCTGGAAGGCTCTGTCTCCCACAAGTTCCTGTCACTACCGATGTTGGTTCGCCAGCTTTGGGACTCTGCGGTGAGCCACTTCTTTTCTCTGCCCTTCAAAAAGAGTCTCCTGGCTGCCTTGATCCTCTGTCTCCTGGTGGTGAGATTTGATCCAGCTTCCCCTTCCTCCCTGCACTTCCTCTACAAGCTGGCCCAGCTCTTCCGCTGGATCCGGAAGGCTGCATTTTCTCGCCTCTACCAGCTCCGCATCCGTGACTGACCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium