Clone: EvNO00061657 ← Click Here To Order

Clone ID:EvNO00061657
Is Verified:U
Status:AVAILABLE
Source:Mekalanos lab
Description:Vector for transposon-based mutagenesis in bacteria, with arabinose-inducible promoter to drive expression of gene adjacent to transposon insert (modified promoter-out approach); kanamycin resistance; restriction enzyme cloning.
Comments:This shipment includes the following items: 1) Purified pNJ17 (Judson and Mekalanos, 2000. PMID: 10888841). 2) E. coli strain DH5alpha lambda pir. 3) E. coli strain BW20767 (Metcalf, et al., 1996. PMID: 8693022). It is recommended that the following approaches be used for handling this plasmid: 1) Avoid single colony isolation for strains containing pNJ17. Instead, it is preferable to scrape up multiple individual colonies from a plate for establishing stocks and cultures. Strain passage should be minimized. This is because the transposon hops out at a relatively high frequency, causing plasmid loss. Plasmid loss cannot be tracked by kanamycin resistance because insertion of the transposon into the host strain chromosome should also cause a resistant phenotype. Please also keep in mind that mariner-containing plasmids can be prone to spontaneous rearrangement. 2) DH5alpha lambda pir is suitable for cloning or plasmid maintenance, but it is not competent to mobilize the plasmid into recipient strains. For mating, the plasmid should be introduced into BW20767 or another mating strain of your choice. Multi-colony isolation should also be used for the mating strains once the plasmid has been introduced.
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:
Map:pNJ17.pdf

Related Identifiers:

Original Clone ID pNJ17
SYNONYM TnAraOut

Sequencing Information:

Phred Score: 0
Date: 2012-05-25

Last Passing Sequencing Read:

CCGGTCTAACAAAGAAAAACACATTTTTTTGTGAAAATTCGTTTTTATTATTCAACATAGTTCCCTTCAAGAGCGATACAACGATTATAACGACCTTCCAATTTTTTGATACCATTTTGGTAGTACTCCTTCGGTTTTGCCTCAAAATAGGCCTCAGTTTCGGCGATCACCTCTTCATTGCAGCCAAATTTTTTCCCTGCGAGCATCCTTTTGAGGTCTGAGAACAAGAAAAAGTCGCTGGGGGCCAGATCTGGAGAATACGGCGGGTGGGGAAGCAATTCGAAGCCCAATTCATGAATTTTTGCCATCGTTCTCAATGACTTGTGGCACGGTGCGTTGTCTTGGTGGAACAACACTTTTTTCTTCTTCATGTGGGGCCGTTTTGCCGCGATTTCGACCTTCAAACGCTCCAATAACGCCATATAATAGTCACTGTTGATGGTTTTTCCCTTCTCAAGATAATCGATAAAAATTATTCCATGCGCATCCCAAAAAACAGAGGCCATTACTTTGCCAGCGGACTTTTGAGTCTTTCCACGCTTCGGAGACGGTTCACCGGTCGCTGTCCACTCAGCCGACTGTCGATTGGACTCAGGAGTGTAGTGATGGAGCCATGTTTCATCCATTGTCACATATCGACGGAAAAACTCGGGTGTATTACGAGTTAACAGCTGCAAACACCGCTCAGAATCATCAACACGTTGTTGTTTTTGGTCAAATGTGAGCTCGCGCGGCACCCATTTTGCACAGAGCTTCCGCATATCCAAATATTGATGAATGATATGACCAACACGTTCCTTTGATATCTTTAAGGCCTCTGCTATCTCGATCAACTTCATTTTACGG

Vector Information:

Vector Name:pNJ17
Type:bacterial plasmid
Description:Vector for transposon-based mutagenesis in bacteria, with arabinose-inducible promoter to drive expression of gene adjacent to transposon insert (modified promoter-out approach); kanamycin resistance; restriction enzyme cloning.
Properties:inducible expression, mutagenesis vector, transposon mediated gene disruption
Comments:This shipment includes the following items: 1) Purified pNJ17 (Judson and Mekalanos, 2000. PMID: 10888841). 2) E. coli strain DH5alpha lambda pir. 3) E. coli strain BW20767 (Metcalf, et al., 1996. PMID: 8693022). It is recommended that the following approaches be used for handling this plasmid: 1) Avoid single colony isolation for strains containing pNJ17. Instead, it is preferable to scrape up multiple individual colonies from a plate for establishing stocks and cultures. Strain passage should be minimized. This is because the transposon hops out at a relatively high frequency, causing plasmid loss. Plasmid loss cannot be tracked by kanamycin resistance because insertion of the transposon into the host strain chromosome should also cause a resistant phenotype. Please also keep in mind that mariner-containing plasmids can be prone to spontaneous rearrangement. 2) DH5alpha lambda pir is suitable for cloning or plasmid maintenance, but it is not competent to mobilize the plasmid into recipient strains. For mating, the plasmid should be introduced into BW20767 or another mating strain of your choice. Multi-colony isolation should also be used for the mating strains once the plasmid has been introduced.
Map:pNJ17.pdf
Sequence:pNJ17.txt
Size (bp):6722
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha lambda pir Y clone provided in DH5-alpha lambda pir (Mekalanos lab)

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
John Mekalanos Academic researcher, PI
Su Chiang Academic researcher, clone donor
Nicholas Judson Academid researcher, clone first author

Publications:

PMID Title
10888841 TnAraOut, a transposon-based approach to identify and characterize essential bacterial genes