Clone: EvNO00061636 ← Click Here To Order

Clone ID:EvNO00061636
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Lentiviral vector that expresses insert from internal short EF1a promoter, after MCS for insert is IRES-ZsGreen fluorescent marker, with WPRE; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pHAGE-shortEF1a-MCS-IRES-ZsGreen-W

Sequencing Information:

Phred Score: 784
Date: 2017-02-22

Last Passing Sequencing Read:

>26747-44_EvNO00061636-IRES-F_D6 784 1373 46 817 NNNNTTCAGGNNNNNNGGCCAGCTAGAGCCCAGGTACCCCATTGTATGGG ATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGT TAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGA AAAACACGATGATAATATGGCCACACATATGGCCCAGTCCAAGCACGGCC TGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGC CACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAA GCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCG AGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAG TACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTA CACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCA ACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCC AAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGAT GACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGC AGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGT GGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCC CCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGG ACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGAACGAGCACGCCATC GCCTCCGGCTCCGCCTTGCCNTGAATCGATAGATCCTAAATCACCTCTGG NATACAAAATTNGTGAAAAGATGACTGGTATTCNTAACTATGTGGCTCCC TTTACGCTATGTGGATACGCTGCTTNNAATGCCTTNGTATCATGCTATTG CTTCCCGNATGGCCTTCATTTTCCCCTCCTGNAAAAACCNGGTTGCCGTC CCCTTATGAAGAGTTGTGGCCGTTGTCAGCAACTTGGCCGGGTTGGCCTG GGGTTGCTGACCCACCCCACTGTTGGGGCATTGCCCACCTGTCAGTCCTT TCGGGAATTTCCTTCCCCCCCATTGCCCGGGGAAATCATCCCCCTGCTTC CCCTTTGAAAGGGCCCCCGTTTGGCATAAAATCCGGGGTTCGGGAAAACC CCTTTCTGGGGCCCCCGGTCCCCGGTACCGGGAAATTTTTTTGATCCTTC GCCACAAAAAAACTTTTCCGGGGGGGGGGGGGCTCTCCGCTTCCCCTCCC

Vector Information:

Vector Name:pHAGE-shortEF1a-MCS-IRES-ZsGreen-W
Type:bacterial plasmid
Description:Lentiviral vector that expresses insert from internal short EF1a promoter, after MCS for insert is IRES-ZsGreen fluorescent marker, with WPRE; ampicillin resistance; restriction enzyme cloning.
Properties:fluorescent marker, lentiviral infection, mammalian expression, mammalian transduction, multiple cloning site, retroviral vector, with tag/fusion/marker
Comments:Note that there is also a "full EF1a" promoter version in the repository database.
Map:pHAGE-shortEF1a-MCS-IZsGreen-W.pdf
Sequence:pHAGE-shortEF1a-MCS-IZsGreen-W.txt
Size (bp):7386
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N E. coli host strain DH5-alpha (is recommended by clone donor)
EB5-alpha Y T1, T5 phage-resistant E. coli host strain EB5-alpha (DH5-alpha-like strain) from EdgeBiosystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Academic researcher, clone donor and PI