Clone: EvNO00061629 ← Click Here To Order

Clone ID:EvNO00061629
Is Verified:U
Status:AVAILABLE
Source:Mekalanos lab
Description:Vector for transposon-mediated mutagenesis in mycobacteria, with ts origin of replication, mariner transposase and transposon, mycobacterial promoter for selectable marker; gentamycin, kanamycin, tetracycline resistance (kanamycin for selection of insertions in mycobacteria); restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:
Map:

Related Identifiers:

SYNONYM pMycoMar in XL1Blue
Original Clone ID pMycoMar
SYNONYM Mekalanos Strain C35

Sequencing Information:

Phred Score: 0
Date: 2012-04-06

Last Passing Sequencing Read:

GGCGAATGGGCCCTNAGATGCATGCTCGAGCGGCCGCCAGTGTGATGGATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTAACAGGTTGGCTGATAAGTCCCCGGTCTGACACATAGATGGCGTCGCTAGTATTAAATGCATATTATTTTTATATAGTACCAACCTTCAAATGATTCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCGAGGACGCGTCGAGGATCCCCGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAAGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACACCTATTAATTTCCCCTCGTCAAAAAAAGGTTATCAAATGAGAAACACCATGAGTGACGACTGAATCCCATGAAAATGGGAAAACTTATGCATTTCTTTCCAAACTTGTTCAACAGCCATCCATTACGCTCGTTCTCAAAATCAATCCCATCAACAAAACCGTTATCAATTCCGAATGCCCCCGGACCAGACAAAAACCCCATCCCTGTTAAAAGGCAATTCCAAAGGGAATCCATGCCACCGGCTCAAGAAACCTGCCCCGCCACCACAAATTTTTCCCGAAACCAGAATTCTTTCAAACGGGAATGGTTTTTCCCGGGAACCCAGGTTGATTCCCACGCCACCAGAGAACCGATAATGTTTGGGGCTGAAAAGCAAAATCCCCCCCGTTTATTGAG

Vector Information:

Vector Name:pMycoMar
Type:bacterial plasmid
Description:Usage notes: 1) pMycoMar can be propagated in standard E. coli cloning strains such as DH5alpha. Strain passage should be minimized to reduce the possibility of plasmid loss due to transposition of the MycoMar transposon out of the plasmid. Please also keep in mind that mariner- containing plasmids can be prone to spontaneous rearrangement. 2) The MycoMar transposon contains an oriR6k origin of replication, which requires the pir protein in trans for replication. The E. coli strain DH5alpha lambda pir is suitable for propagation of oriR6K- containing plasmids and is provided to facilitate recovery of transposon insertion junctions.
Properties:mutagenesis vector, transposon mediated gene disruption
Comments:1) Purified pMycoMar (Rubin, et al., 1999. PMID: 9990078) 2) E. coli strain DH5alpha lambda pir
Map:pMycoMar.jpg
Sequence:
Size (bp):0
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
XL1 Blue Y E. coli host strain XL1 Blue (Mekalanos lab)

Antibiotic Selections:

Host Type Marker
bacterial gentamicin
bacterial kanamycin
bacterial tetracycline

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
John Mekalanos Academic researcher, clone PI
Su Chiang Academic researcher, clone donor

Publications:

PMID Title
9990078 In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria