Clone: EvNO00061626 ← Click Here To Order

Clone ID:EvNO00061626
Is Verified:U
Status:AVAILABLE
Source:Mekalanos lab
Description:Vector for bacterial in vivo expression technology (IVET) transposon insert-based approach to identification of promoters that drive expression of promotorless marker in the vector; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:
Map:

Related Identifiers:

SYNONYM pIVET8 in DH5-alpha lambda-pir
Original Clone ID pIVET8
SYNONYM Mekalanos Strain C5

Sequencing Information:

Phred Score: 0
Date: 2012-04-06

Last Passing Sequencing Read:

GAATACGCTGAAAAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCCTTTTTGTCCGGTGTTGGGTTGAAGGTGAAGCCGGTCGGGGCCGCAGCGGGGGCCGGCTTTTCAGCCTTGCCCCCCTGCTTCGGCCGCCGTGGCTCCGGCGTCTTGGGTGCCGGCGCGGGTTCCGCAGCCTTGGCCTGCGGTGCGGGCACATCGGCGGGCTTGGCCTTGATGTGCCGCCTGGCGTGCGAGCGGAACGTCTCGTAAGAGAACTTGACCTTCACCGTTTCCCGCATGTGCTCCCAAATGGTGACGAGCGCATAGCCGGACGCTAACGCCGCCTCGACATCCGCCCTCACCGCCAGGAACGCAACCGCAGCCTCATCACGCCGGCGCTTCTTGGCCGCGCGGGATTCAACCCACTCGGCCAGCTCGTCGGTGTAGCTCTTTGGCATCGTCTCTCGCCTTGTCCCCTCGATCAATAATTTCCTGCTTTTGCCGTTTCCAGTCGGTAGATATCCACAAAACACCGGGAAACAGCGCTTTTCCGTGGCTACCCTGGTTCGGGGTCATTATACCGATTTTTCCGGAAATCCATCCTTTTTCCCCCAATAAAAGAATTTTGCCAAAGGTTCCTGTAGACTTCCTTGGGGTACCAACGGCCCCACCCGGAAGGATATGTGAAAAGGCCCCCCCGGAGCGGGGGTCCTTTTTC

Vector Information:

Vector Name:pIVET8
Type:bacterial plasmid
Description:Vector for bacterial in vivo expression technology (IVET) transposon insert-based approach to identification of promoters that drive expression of promotorless marker in the vector; amp resistance; restriction enzyme cloning.
Properties:bacterial expression, promoter trap, transposon mediated gene disruption
Comments:
Map:
Sequence:
Size (bp):0
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha lambda-pir Y E. coli host strain DH5-alpha lambda-pir

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
John Mekalanos Academic researcher, clone PI
Su Chiang Academic researcher, clone donor

Publications:

PMID Title
7846034 Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host
9023360 Bacterial infection as assessed by in vivo gene expression