Clone: EvNO00061624 ← Click Here To Order

Clone ID:EvNO00061624
Is Verified:U
Status:AVAILABLE
Source:Mekalanos lab
Description:Vector that accepts insert for gene targeting approach in bacteria; amp, streptomycin (tetracycline? See map); restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:
Map:pGP704

Related Identifiers:

SYNONYM GP704 in BW19851
Original Clone ID pGP704
SYNONYM Mekalanos Strain C1

Sequencing Information:

Phred Score: 818
Date: 2016-01-29

Last Passing Sequencing Read:

CCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGCAGATCTGCAGGTCGACGGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGATATCGAGCTCTCCCGGGAATTCCACAAATTGTTATCCGCTCACAATTCCACATGTGGAATTCCACATGTGGAATTCCCATGTCAGCCGTTAAGTGTTCCTGTGTCACTCAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTACATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTG

Vector Information:

Vector Name:pGP704
Type:bacterial plasmid
Description:Vector that accepts insert for gene targeting approach in bacteria; ampicillin, streptomycin (tetracycline? See map); restriction enzyme cloning.
Properties:bacterial expression, gene targeting
Comments:
Map:pGP704.gif
Sequence:pGP704_seq.doc
Size (bp):3705
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
BW19851 Y E. coli host strain BW19851

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial streptomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
John Mekalanos Academic researcher, clone PI
Su Chiang Academic researcher, clone donor

Publications:

PMID Title
2836362 A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR
728998 Trans-complementation-dependent replication of a low molecular weight origin fragment from plasmid R6K