Clone: EvNO00061616 ← Click Here To Order

Clone ID:EvNO00061616
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Helper plasmid for lentiviral vector, rev1b driven by CMV promoter; amp resistance; not a cloning vector.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pRC/CMV-rev1b
SYNONYM pRC/CMV-rev1b

Sequencing Information:

Phred Score: 886
Date: 2017-06-08

Last Passing Sequencing Read:

>27367-65_EvNO00061616-CMV-F_A9 886 1394 39 953 NNNNNNNCGTTGGCTTACGAGCTCCTGGCTACTAGAGAACCCACTGCTTA CTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTTGGT ACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTCTGCA GATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGACTGCCATGG CAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAAGGCAGTCAGACTC ATCAAGTTTCTCTATCAAAGCAACCCACCTCCCAACCCCGAGGGGACCCG ACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGA TCCATTCGATTAGTGAACGGATCCTTAGCACTTATCTGGGACGATCTGCG GAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTG TAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAA TATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGGAT CCGGCTATTCTATAGTGTCACCTAAATGCTAGAGCTCGCTGATCAGCCTC GACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGC CTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAAT GAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGG TGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGC ATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGC TGGGGCTCGAGGGGGGATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGC GGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGNCAGCGCCC TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCTTTCTCNGCACGTTCGCCG GCTTTCCCCCGTCAGCTCTAAATCGGGGGCTCCCTTAAAGGGTTCGATTT AGTGCTTTACGGCACCTCACCCCNAAAACTTGATTAAGGTGATGTTTCAG TANTGGCCCTCGCCCTGATAGACGGTTTTCGCCCTTTGACGTGGAGTCAC GTTCTTAAAAGTGAACTCTGGTCCAACTGAAACACCTCAACCTATCTCGG CAATCCTTTGATTTAAAGGATTTGCCGATTCGCCCTTGGTTAAAAATGAC TATTTAAAAAATTTCCCCAATTTACAAAATTAACCTCAAATTAAATTTGC TAAACACCTCCGTTTGGGGCTTTCAATACCCGGGGGGGCCAGACAAATTG

Vector Information:

Vector Name:pRC/CMV-rev1b
Type:bacterial plasmid
Description:Helper plasmid for lentiviral vector, rev1b driven by CMV promoter; amp resistance; not a cloning vector.
Properties:lentiviral helper, lentiviral infection, mammalian expression, mammalian transduction
Comments:
Map:pRC-CMV-rev1b.pdf
Sequence:pRC-CMV-rev1b.txt
Size (bp):5900
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
mammalian neomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone PI