Clone: EvNO00061610 ← Click Here To Order

Clone ID:EvNO00061610
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Lentiviral vector with internal CMV promoter that drives eGFP fluorescent tag; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pHRST-eGFP
SYNONYM pHRST-IRES-eGFP
SYNONYM pHIeGFP
SYNONYM pHRST-eGFP

Sequencing Information:

Phred Score: 907
Date: 2017-11-16

Last Passing Sequencing Read:

>28251-1_EvNO00061610-SV40_A1 907 1513 36 987 NGGCCAGGNNNNNGGGCAAATATCAGATATTATATACCTAATAGATTGTA ATGCTAAATAAAGTTGTTATACTGTGCTGTTTTTCTGATTTGTATTTTTT TATTGTTGTATTGCTATTTTTAATTTTTTCCCAATATTTTTGATCCACAG TTGGTTGGATTTTTGTTGTGGAACCTGCAGATGAGGAAGGCTGACTTTAT ATGATAATATCAAACTGGAAAAATTGATGTTAGAATAAAGATGTGTTTCT GAGATTAAATTAGATTTTAATAAAAATTACCCCAGTCTCAGGTTTTCTAT CTGCAATGTGAAATGATCTCAGAGAAGAATAAATTTTAACCATTTACATT ATTAAATTGAAATCACTAAAAGTAAAACAAAGGTGTGAGACTATATAATA GATTGTTTTCCTTATTTCAGAGTCTTTGGAACAAATTCTTCCAAGATAAA GAACTTCGATCAATGATTGAACAAGATGTCAAAAGAACGTATGTAGAACT ATTTACATGTTACTTTCAATAATTCAAATTGTTGTTATCTCTTTCTAATT TTAACAAAACACAAAATCTGCAGTCAACTTAATTGAATGCAGTATTCTAC TTGTGTTAATAACAAACTTGTTTTGACAAATTGTGATAATAAGGATTGTT TTCTACTCTAATGATACACATTTCTATGTTCCCTTTTTAAAAGTAAATTA CATTTATAATATTGATAATCTTCAATAATATTTAATTAGTTTTATCAAGT TCCAACAATTATTTGAAGTCATATTTAAGGTTATATTGTATAGTCTTGTT GCCAGAAAAATTTATCCCTTGCTTTATGCATTTGAATCCCTTTCTAACCA AGTTACTTGTTAAAACTTGTTAAATGACAACTGTTATTCTTATCCTCACT TCTCTTCTTCTTGAAGCTATTCAGGTTTTGCAAACATTTCTTCTCTCAAT CTACTCAGTATTTACTATATAAAAGGGTAATTTGTTACTTANCATAATGT CCATAACTTTGATATATTCGACTGAGTCATAGGGTGAGGAGTAAATGGGA TTGGTGTCAGAGGATCATAGAGTCGTAACTAACGGATGCTGTAATGGGGG AAAAATACTTTCACATCTTCCCTCCCAATTTCCTCTTGGGTAAAAGGGGA TATAATAATCCTCTCTTAGAAATTGGAGATTAATAAATCTGTCCGATAGT AATTTAATAATTTAACTTTAACCTTAATCATTTATAAAGTTAGTAACTAA TGTATCCTTAGATCGGGATACCAGGATTGGCAAACGGAAAATCTCGGGGC CCTCAAGATTTGGCCTTTGCGGGGCCCCACCAAGTAATCCGGAAACAATA AAGGCAGCCCCCCCTCCAATACTTCTTTGAATAAACGGAAAAAAAAGACC ACGCGGAATTCCCGAAAAGGGGGGATCTTTTCACACCAAGGGCCCTTAAA CCCGGTTTTTTAGGGTTCTTAAACCCCATTTATAAACAAAAAATTTTGGT

Vector Information:

Vector Name:pHRST-eGFP
Type:bacterial plasmid
Description:Lentiviral vector with internal CMV promoter that drives eGFP fluorescent tag; amp resistance; restriction enzyme cloning.
Properties:fluorescent marker, lentiviral infection, mammalian expression, mammalian transduction, multiple cloning site, retroviral vector, with tag/fusion/marker
Comments:
Map:pHRST-eGFP.pdf
Sequence:pHRST-eGFP.txt
Size (bp):10641
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI