Clone: EvNO00061607 ← Click Here To Order

Clone ID:EvNO00061607
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Helper plasmid for lentiviral vector, has codon optimized HIV gag-pol driven by CMV promoter; amp resistance; not a cloning vector.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pHDM-Hgpm2
SYNONYM pHDM-Hgpm2

Sequencing Information:

Phred Score: 887
Date: 2017-06-09

Last Passing Sequencing Read:

EvNO00061607-2-CMV-F_B2 887 1399 35 952 NNNNNTTCGGTGGCTTACAGACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCA GCCTCCCCTCGAAGCTGATCCTGAGAACTTCAGGGTGAGTCTATGGGACC CTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGG AAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTG CATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTT ATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGA TACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATA TAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAAT CCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATT CTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTT CCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACT TTGGCAAAGAATTCTAGACTGCCATGGGCGCCCGCGCCTCCGTGCTGTCC GGCGGCGAGCTGGACAAGTGGGAGAAGATCCGCCTGCGCCCCGGCGGCAA GAAGCAGTACAAGCTGAAGCACATCGTGTGGGCCTCCCGCGAGCTGGAGC GCTTCGCCGTGAACCCCGGCCTGCTGGAGACCTCCGAGGGCTGCCGCCAG ATCCTGGGCCAGCTGCAGCCCTCCCTGCAAACCGGCTCCGAGGAGCTGCG CTCCCTGTACAACACCATCGCCGTGCTGTACTGCGTGCACCAGCGCATCG ACGTGAAGGACACCAGGNNAGTCCTGGACAAGATCGAGGAAGAGCAGAAC AAGTCAAGAAGAAGCCCAGCAGGTCGTCGCCGACACGGGCAACACTCCCA GTGTCCCAGACTACCCATCGTGCAAATCTGCAAGGCAAATGTGCACCAGC CATCTCCCCCGCACCTGAACGTCTGGGTAAAGTGGTGGAAGAAAAGCTTC CTCCCGAAATCATCCATGTTTCCGCCTGTTCGAGGGGCCCCCCCAGACTG AAACCATGCTAACACGGGGGCGGCCCAGCCGCTTGCAATCTGAGGAACTT CACAAGAGGCCCCATTGGACCCTGTCCCTGGAACGGGCCTTCCCCGGAAA TGGAACCCCGGTTCAATTCGGCCCCTCCCTTAAAAGAAGGGGAAACAAAC CCCTCCCGGGAAATAAACGGATTTGGCGAAAAATGGGTCTCCCCCCTGGA

Vector Information:

Vector Name:pHDM-Hgpm2
Type:bacterial plasmid
Description:Helper plasmid for lentiviral vector, has codon optimized HIV gag-pol driven by CMV promoter; amp resistance; not a cloning vector.
Properties:lentiviral helper, lentiviral infection, mammalian expression, mammalian transduction
Comments:
Map:pHDM-Hgpm2.pdf
Sequence:pHDM-Hgpm2.txt
Size (bp):8908
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI