Clone: EvNO00061606 ← Click Here To Order

Clone ID:EvNO00061606
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Helper plasmid for murine leukemia virus (MLV) or lentiviral vectors, CMV promoter drives VSV-G envelope protein, contains human beta globin intron and polyA; amp resistance; not a cloning vector.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pHDM-G
SYNONYM pHDM-G

Sequencing Information:

Phred Score: 851
Date: 2017-06-08

Last Passing Sequencing Read:

>27367-62_EvNO00061606-CMV-F_F8 851 1346 33 920 NNNCCCGGTGGTATAGCGACTCGTTAGTGACCGTCAGATCGCCTGGAGAC GCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGC CTCCCCTCGAAGCTGATCCTGAGAACTTCAGGGTGAGTCTATGGGACCCT TGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAA GGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCA TTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTAT CTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATA CAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTT CTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATA AATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCC AGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCT GAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCC TCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTT GGCAAAGAATTCTGACACTATGAAGTGCCTTTTGTACTTAGCCTTTTTAT TCATTGGGGTGAATTGCAAGTTCACCATAGTTTTTCCACACAACCAAAAA GGAAACTGGAAAAATGTTCCTTCTAATTACCATTATTGCCCGTCAAGCTC AGATTTAAATTGGCATAATGACTTAATAGGCACAGCCTTACAAGTCAAAA TGCCCAAGAGTCACAAGGCTATTNCAGCAGACGGTTGGATGTGTCATGCT TCCAAATGGGTCACTACCTGTGATTTCCGCTGGTATGGACCGAAGTATAT AACACATTCCATCCGATCCTTCACTCCATCTGTAAAACAATGCAAGGAAA ACATTGACAAACGAAACAAGAACTTGGCTGAATCCAGCTTCCCTCCTCAA ATTGTGAATAGCACTGTGACGGAGCGAAAACATGATGGTCAGTGACCCTC ACATGGTGCTGTTGATAATCACAGGAAAAGGGTTGATCAGTTCTCCACGA AATGCGCATTACTATGCCCCTGGCAAATTCTACACGGGATTCGAATAAGC AAGGGTTTTATTAACCCTTTTCGGGAACCTTTTCCAAGAAGGAACTCTTC TGGAAGGGCCAGGTTAAAAATCTTTTTTAAAGGGGGGGCGCAAAAAACCC

Vector Information:

Vector Name:pHDM-G
Type:bacterial plasmid
Description:Helper plasmid for murine leukemia virus (MLV) or lentiviral vectors, CMV promoter drives VSV-G envelope protein, contains human beta globin intron and polyA; amp resistance; not a cloning vector.
Properties:MLV helper, lentiviral helper, lentiviral infection, mammalian expression, mammalian transduction
Comments:For use as helper with lentiviral vector, separate source of rev (e.g. pRC/CMV-rev1b) is needed.
Map:pHDM-G.pdf
Sequence:pHDM-G.txt
Size (bp):6237
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI