Clone: EvNO00061605 ← Click Here To Order

Clone ID:EvNO00061605
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Lentiviral vector with internal CMV promoter, has IRES-ZsGreen (IRES-fluorescent tag); amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pHAGE-CMV-MCS-IRES-ZsGreen
SYNONYM pHCMIZG
SYNONYM pHAGE-CMV-MCS-IRES-ZsGreen
SYNONYM pHAGE-CMV-MCS-IRES-ZsGreen-W

Sequencing Information:

Phred Score: 882
Date: 2018-04-11

Last Passing Sequencing Read:

>28989-35_EvNO00061605-CMV-F_C5 882 1535 35 939 NTTTTACTGTGGACTTACANACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGCGGCCGCACC GGTCTGCAGCTAGCTCGAGTCTAGAGGATCCCTCCCCCCCCCCTAACGTT ACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTT ATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTG GCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAA GGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGC TTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACC CCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGAT ACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGT TGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGA AGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGG TGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCC CCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATG GCCACACATATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCAT GAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCG GCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGC GTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGC CTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCG ACTACTTTCAGAACTCCTGCCCCCGCCGCTACACCTGGGAACGCTCCTTC CTGNTTNCGAGACGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAG CGTGGAAGAAGACTGCATGTACCACGAGTCCAGTTCTACGGGGTGAACTT CCCCGCCGACGCCCCCTGATGAAAAGAATGACCGACACTGGGAGCCCTCT GCCAGAAGACATCCCGTGCCCAGCAGGNCATCTGAAGGGCGACCTGACTG TACTGCTGCTTAAGGACGGGCCGCTTGCCTGCCNTTCAAACCCTGTAAAG CCAAGTCCGGCCCCGAAATGCCCATTGGCTTCCCCCCACAATTGACCCCA GACCNACGGACCAAAACAAAGTGGCTGANGAAAACCACCCCCGGTCCCTG GCCGAAAAAAACTAAACCCGGATAAAATTTGAAAAGCGTGTCTAATTTCT TTCACTTGGAAACCTTAAGCTTAAGATTTTCGCAGGTTTTCCTCCTAAAA NGGNTCTTAAAGAGGCCGAAAAGGGGGGGGGTTACCCCGGGGGAACACCT

Vector Information:

Vector Name:pHAGE-CMV-MCS-IRES-ZsGreen
Type:bacterial plasmid
Description:Lentiviral vector with internal CMV promoter, has IRES-ZsGreen (IRES-fluorescent tag); amp resistance; restriction enzyme cloning.
Properties:fluorescent marker, mammalian expression, mammalian transduction, multiple cloning site, retroviral vector, with tag/fusion/marker
Comments:ZsGreen reported to be like GFP but brighter (statement not evaluated by the DNA Resource Core).
Map:pHAGE-CMV-MCS-IZsGreen.pdf
Sequence:pHAGE-CMV-MCS-IZsGreen.txt
Size (bp):7742
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha T1, T5 phage resistant Y EB5-alpha host as supplied by Edge BioSystems

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI