Clone: EvNO00061600 ← Click Here To Order

Clone ID:EvNO00061600
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Adeno-associated viral (AAV) vector with CMV promoter, human beta globin intron, SV40 polyA signal, maximum capacity for insertion 1.7 kb, has IRES-ZsGreen (IRES-fluorescent tag) as marker of transduced cells; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pAAV-MCS8-IZsGreen
SYNONYM pAAV-MCS8-IZsGreen

Sequencing Information:

Phred Score: 791
Date: 2016-09-30

Last Passing Sequencing Read:

>26030-36_EvNO00061600-CMV-F_D5 791 1465 37 848 NNAAAAGCGGGCTAAGCAACTCGTTAGTGACCGTCGATCGCCTGGAGACG CCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCC TCCCCTCGAAGCTTACATGTGGTACCGAGCTCGGATCCTGAGAACTTCAG GGTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGT TAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGACC AAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTT AATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTC TTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAA AGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCAT ATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTG CTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGG GATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATG TTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTG TGTGCTGGCCCATCACTTTGGCAAAGAATTCCGCGGGCGGCCGCTCTAGA GGATCCAAGCTTATCGATACCGTCGACCTCGAGTGCTTTATTTGTGAGAT TTGTGATACTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAG TTAACAACAACAATTGCATTCATTTTATTGTTTCAAGTTCAGGGGGAGGT GTGGGAGGTTTTTTAACGGCGCAGGGGGTACCTACATAAATAGCATGGCG GCTTCATCCTGTCTACAACGCACCTCTACTGATGGATTGGCCACTCCTCT CGGCGCGATAGGAACTCCTGCCCCGCCGCTTCACTTGGAACCCTCCTTCC TTTTCAGAGCGGCCCCCAGTGCATCTTCCAGGCGAACACCCGGTGAACGG GACGAAAACAGGGTGTCCACTTATCCAAGTCCTACGCTTGAACTCCCCCC CAAGGCCCCCTTAGAAAAACAGACGAAAACTGGGGACCTTCAGCGAAAAA ACACCCCAGCCCAACGGGGATCCTTAAGGCCCATGAACCTTTCCTGCTTC TAAGACAGTGTCCCATACCCTTCCTTTCGAACCGGTTAAAGCCAATCCAT CCCCAAATAACCCAATGCCCTTTACANCAAAGTGACCCGGGGACCCGGGC CCCAAAACTAATGGGCCCCGCGGAACTCCTTCCTCGGGCCTCTTGCAGAA ACCCCCGGGATTTATGTAAAATTGAAATTGTTTTTTAACCATACCCCAAA AAGACCAACAATGTTTTTTTTTTGCGCGGCAGGGGGATTTTTTGGGGGGG

Vector Information:

Vector Name:pAAV-MCS8-IZsGreen
Type:bacterial plasmid
Description:Adeno-associated viral (AAV) vector with CMV promoter, human beta globin intron, SV40 polyA signal, maximum capacity for insertion 1.7 kb, has IRES-ZsGreen (IRES-fluorescent tag) as marker of transduced cells; amp resistance; restriction enzyme cloning.
Properties:adeno-associated (AAV) expression, fluorescent marker, mammalian expression, mammalian transduction, multiple cloning site, with tag/fusion/marker
Comments:Each time the plasmid is replicated and amplified, should check with a SmaI digest to ensure that the full plasmid is intact. XLBlue cells recommended over DH5-alpha. ZsGreen like eGFP but brighter (statement not confirmed at DNA Resource Core).
Map:pAAV-MCS8-IZsGreen.pdf
Sequence:pAAV-MCS8-IZsGreen.txt
Size (bp):6696
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
XL Blue Y XL Blue cells from Stratagene (XL Blue recommended by donor)

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI