Clone: EvNO00061596 ← Click Here To Order

Clone ID:EvNO00061596
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Adeno-associated viral (AAV) vector with CMV promoter, beta globin intron and polyA signal, maximum capacity for insertion 2.3 kb; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pAAV-MCS
SYNONYM pAAV-MCS

Sequencing Information:

Phred Score: 956
Date: 2017-02-17

Last Passing Sequencing Read:

>26727-16_EvNO00061596-1-CMV-F_H2 956 1289 37 974 NNNNCCGTGCGTATTACAACTCGTTAGTGACCGTCGATCGCCTGGAGACG CCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCC TCCCCTCGAAGCTGATCCTGAGAACTTCAGGGTGAGTCTATGGGACCCTT GATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAG GGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCAT TTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATC TTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATAC AATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTC TGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAA ATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCA GCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTG AGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCT CCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTG GCAAAGAATTCCGCGGGCGGCCGCTCTAGAGGATCCAAGCTTATCGATAC CGTCGACCTCGAGGGCCCAGATCTAATTCACCCCACCAGTGCAGGCTGCC TATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCT GGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAA ATTATTTCTGAATATTTTTACTAAAAGGGAATGTGGGAGGTCAGTGCATT TTAAAACATAAGAAATGAAGAGCTAGTTCAAACCTTGGGAAATACACTAT ATCTTAAACTCCATGAAAGAAGGTGAGGCTGCAACAAGCTATGCACATGG GCAACAGCCCCTGAATGCTATGCCNTTATCATCCTCAGAAAAAGATCAAG TAAGAGCTGGATTTGAAGNTAAAGTTTGCTATGCTGAATTTAAATAACTA ATGTTTAGCGGCCCAGGAATGTCCTTCCCTACCATTTGCTATCTGAATTT

Vector Information:

Vector Name:pAAV-MCS
Type:bacterial plasmid
Description:Adeno-associated viral (AAV) vector with CMV promoter, beta globin intron and polyA signal, maximum capacity for insertion 2.3 kb; amp resistance; restriction enzyme cloning.
Properties:mammalian transduction
Comments:Each time the plasmid is replicated and amplified, should check with a SmaI digest to ensure that the full plasmid is intact. XLBlue cells recommended instead of DH5-alpha.
Map:pAAV-MCS.pdf
Sequence:pAAV-MCS.txt
Size (bp):6150
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
XL Blue Y XL Blue cells from Stratagene (XL Blue recommended by donor)

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI