Clone: EvNO00061595 ← Click Here To Order

Clone ID:EvNO00061595
Is Verified:U
Status:AVAILABLE
Source:Lee lab (HGTI/HMS)
Description:Adeno-associated viral (AAV) vector, CMV promoter drives GFP fluorescent marker; amp resistance; restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Original Clone ID pAAV-GFP
SYNONYM pAAV-GFP

Sequencing Information:

Phred Score: 882
Date: 2018-02-14

Last Passing Sequencing Read:

>28643-22_EvNO00061595-1-CMV-F_F3 882 1454 36 906 NNNNNCCCGGGGCATTACAAACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCA GCCTCCCCTCGAAGCTGATCCTGAGAACTTCAGGGTGAGTCTATGGGACC CTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGG AAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTG CATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTT ATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGA TACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATA TAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAAT CCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATT CTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTT CCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACT TTGGCAAAGAATTCCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGA GCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTG GACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGG CGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA AGCTGCCCGTGCCCTGACCCACCCTCGTGACCACCCTGACCTACGGCGTG CAGTGCTTCAGCCGCTACCCCGAACACATGAAGCAGCACGACTTCTTCAA GTCCGCCATGCCCGAANGCTACGTCCAGGAGCGCACCATCTTTCTCNAGG ACGAANCGCACTACAAGACCCGCGCCGAAGTGAAGTTCGAGGNCGACACC CTGNTGAACCGCATCGAGCTGAAGGGCATCGACTTTCANGGAGTACGNCA CATCCTGGGGCACAGCTGGAGTACACTACNACACCACAACGTCTATTCAT GGCCGACAGCAAAAAAACGCATCAGGGTGACCTTCAGATCGTCCAAAATC AAGGAAGNAGNTTGTAATTCGCGAACATTACACNAAAACCCCCATGGGGA GGGCCCGGGTGGTGCCAAAAACCTACTGAGCCCAATCGCCTGACAAAACC CCAAAAGGCGATCCTGGCCTGGTGAATTGGAACCCCCGAATTCTCGATGA GAATTTTAAAAAGCGCCCTAAAGAAAATTTATATCCACCCGGGGCATTTA TTCCCCGGGGGTTCTAAAGGTGTGGGTAACGGCCAAAATAAATTTTTTTT

Vector Information:

Vector Name:pAAV-GFP
Type:bacterial plasmid
Description:Adeno-associated viral (AAV) vector, CMV promoter drives GFP fluorescent marker; amp resistance; restriction enzyme cloning.
Properties:mammalian transduction
Comments:Each time the plasmid is replicated and amplified, should check with a SmaI digest to ensure that the full plasmid is intact. XLBlue cells recommended instead of DH5-alpha.
Map:pAAV-GFP.pdf
Sequence:pAAV-GFP.txt
Size (bp):6940
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
XL Blue Y XL Blue cells from Stratagene (XL Blue recommended by donor)

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.

Authors:

Author Name Author Type
Jeng-Shin Lee Adademic researcher, clone donor and PI

Publications:

PMID Title
25798616 NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage