Clone: HsCD00005569

Clone ID:HsCD00005569
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

Original Clone ID FLH130905.01L
HIP Clone ID 130905
GI 60834910
GenBank Accession AY894079
HIP Master Clone ID 107062

Property:

Collection: Breast Cancer 1000

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 804 Homo sapiens FUSION 1st strand cDNA from placenta and brain 5179 PENK proenkephalin
Insert1
Size (bp)804
SpeciesHomo sapiens
FormatFUSION
Tissue Source1st strand cDNA from placenta and brain
Species Specific ID 5179
Gene SymbolPENK
Gene Nameproenkephalin
Keyword

Insert Sequence:

ATGGCGCGGTTCCTGACACTTTGCACTTGGCTGCTGTTGCTCGGCCCCGGGCTCCTGGCGACCGTGCGGGCCGAATGCAGCCAGGATTGCGCGACGTGCAGCTACCGCCTAGTGCGCCCGGCCGACATCAACTTCCTGGCTTGCGTAATGGAATGTGAAGGTAAACTGCCTTCTCTGAAAATTTGGGAAACCTGCAAGGAGCTCCTGCAGCTGTCCAAACCAGAGCTTCCTCAAGATGGCACCAGCACCCTCAGAGAAAATAGCAAACCGGAAGAAAGCCATTTGCTAGCCAAAAGGTATGGGGGCTTCATGAAAAGGTATGGAGGCTTCATGAAGAAAATGGATGAGCTTTATTCCATGGAGCCAGAAGAAGAGGCCAATGGAAGTGAGATCCTCGCCAAGCGGTATGGGGGCTTCATGAAGAAGGATGCAGAGGAGGACGACTCGCTGGCCAATTCCTCAGACCTGCTAAAAGAGCTTCTGGAAACAGGGGACAACCGAGAGCGTAGCCACCACCAGGATGGCAGTGATAATGAGGAAGAAGTGAGCAAGAGATATGGGGGCTTCATGAGAGGCTTAAAGAGAAGCCCCCAACTGGAAGATGAAGCCAAAGAGCTGCAGAAGCGATATGGGGGCTTCATGAGAAGAGTAGGTCGCCCAGAGTGGTGGATGGACTACCAGAAACGGTATGGAGGTTTCCTGAAGCGCTTTGCCGAGGCTCTGCCCTCCGACGAAGAAGGCGAAAGTTACTCCAAAGAAGTTCCTGAAATGGAAAAAAGATACGGAGGATTTATGAGATTTGAC

Insert Property: Insert 1

Type Value Extra Information
Discrepancy c355t,P119S
End on reference sequence 880
Start on reference sequence 77

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGGCGCGGTTCCTGACACTTTGCACTTGGCTGCTGTTGCTCGGCCCCGGGCTCCTGGCGACCGTGCGGGCCGAATGCAGCCAGGATTGCGCGACGTGCAGCTACCGCCTAGTGCGCCCGGCCGACATCAACTTCCTGGCTTGCGTAATGGAATGTGAAGGTAAACTGCCTTCTCTGAAAATTTGGGAAACCTGCAAGGAGCTCCTGCAGCTGTCCAAACCAGAGCTTCCTCAAGATGGCACCAGCACCCTCAGAGAAAATAGCAAACCGGAAGAAAGCCATTTGCTAGCCAAAAGGTATGGGGGCTTCATGAAAAGGTATGGAGGCTTCATGAAGAAAATGGATGAGCTTTATTCCATGGAGCCAGAAGAAGAGGCCAATGGAAGTGAGATCCTCGCCAAGCGGTATGGGGGCTTCATGAAGAAGGATGCAGAGGAGGACGACTCGCTGGCCAATTCCTCAGACCTGCTAAAAGAGCTTCTGGAAACAGGGGACAACCGAGAGCGTAGCCACCACCAGGATGGCAGTGATAATGAGGAAGAAGTGAGCAAGAGATATGGGGGCTTCATGAGAGGCTTAAAGAGAAGCCCCCAACTGGAAGATGAAGCCAAAGAGCTGCAGAAGCGATATGGGGGCTTCATGAGAAGAGTAGGTCGCCCAGAGTGGTGGATGGACTACCAGAAACGGTATGGAGGTTTCCTGAAGCGCTTTGCCGAGGCTCTGCCCTCCGACGAAGAAGGCGAAAGTTACTCCAAAGAAGTTCCTGAAATGGAAAAAAGATACGGAGGATTTATGAGATTTGACGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA

Vector Information:

Vector Name:pDONR201
Type:bacterial plasmid
Description:Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr201_pdonr207_map.pdf
Sequence:pDONR201_FASTA.txt
Size (bp):4470
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute