Clone: EvNO00483428 ← Click Here To Order

Clone ID:EvNO00483428
Is Verified:Y
Status:AVAILABLE
Source:DRSC
Description:Empty Drosophila expression vector
Comments: http://flyrnai.org/TRiP-HOME.html
Type:No insert
Verification Method:End read identity check
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 861
Date: 2018-02-21

Last Passing Sequencing Read:

>28688-45_EvNO00483428-5-T7_E6 861 1498 46 902 NNNNAAAGAGCACTCGACTAGCGCGCCCTANTTCAGTGAAATCCAGCATT TTCTAAATTAAATGTATTCTTATTATTATAGTTGTTATTTTTGATATATA TAAACAACACTATTATGCCCACCATTTTTTTGAGATGCATCTACACAAGG AACAAACACTGGATGTCACTTTCAGTTCAAATTGTAACGCTAATCACTCC GAACAGGTCACAAAAAATTACCTTAAAAAGTCATAATATTAAATTAGAAT AAATATAGCTGTGAGGGAAATATATACAAATATATTGGAGCAAATAAATT GTACATACAAATATTTATTACTAATTTCTATTGAGACGAAATGAACCACT CGGAACCATTTGAGCGAACCGAATCGCGCGGAACTAACGACAGTCGCTCC AAGGTCGTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACA GCGAAAGAGCAACTACGAAACGTGGTGTGGTGGAGGTGAATTATGAAGAG GGCGCGCGATTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTA TGTAGCGATAAACGAGTTTTTGATGTAAGGTATGCAGGTGTGTAAGTCTT TTGGTTAGAAGACAAATCCAAAGTCTACTTGTGGGGATGTTCGAAGGGGA AATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGGCACAAATATAA TTACATTAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATAA TGGTAAAAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACTCC TTGCGTCGGGCCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCT CACGATGAGAATGGCCAGACCCACGTAGTCCAGCGGCAGATCGGCGGCGG AGAAAGTAAGCGTCTCCAGGATGACCTTGCCCGAAACTGGGCACGTGGTG TTCGACGATGTGCAGCTAATTTTCGCCCGCTCCACGTCCGCCCATTTGGT TATCAGCAGACCCNTCGTGGGCGTACGAACCCATGAGAGTACGACAACCA TTTGAGTTTACTGGCACCGAGCCCGAGTCAGAAAGAGCCGCCAAAGAGCA GAATGTATGAATACCGGCGACCCACAAAAGCCCTTCGAGTCAAGAACTGG CCAGTATTAAAAATCGAAGACGTGAACCTGNCCACAAATGACCCCGCAGC AATAAAAAGCACATCCGCCCAATCGATCCGAAAGCATCCCGGAAACATGC CTGTAAAAACGGATTCGCACCTTGCCAAAGTTGCAACGAAGTCATCGGCC CTATAAAGCGCCTAGGACACCACACTTTTGAGGGAATGAAGAGGTTCAGG TCTTCGAACATAAGCGGGGAAAAAACCTATTCACCGGGTGCAAAAACAAG GCCCAATCCCTTTCTAATTTCCTATAAAAAGGGNAANNNNNNNNNNTTTT

Vector Information:

Vector Name:pQUAS-WALIUM20
Type:bacterial plasmid
Description:Drosophila expression vector. loxP, and GATEWAY recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, 94-bp QUAS, Hsp70 promoter with ftz intron and SV40 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Two copies of loxp-5xUAS sequences of "pWALIUM20" are deleted and replaced with the 94-bp QUAS sequence (five copies of the QF binding site)
Map:pQUAS-WALIUM20 Map-corrected.pdf
Sequence:pQUAS-WALIUM20.txt
Size (bp):10372
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
drosophila white

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.