Clone: HsCD00045685

Clone ID:HsCD00045685
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 187767
Original Clone ID FLH187767.01X
HIP Master Clone ID 162711

Property:

Collection: Breast Cancer 1000
Collection: HIP human pDONR221 set

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1380 Homo sapiens CLOSED MGC template 2288 FKBP4 FK506 binding protein 4, 59kDa
Insert1
Size (bp)1380
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceMGC template
Species Specific ID 2288
Gene SymbolFKBP4
Gene NameFK506 binding protein 4, 59kDa
Keyword

Insert Sequence:

ATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1533
Start on reference sequence 154

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute