Clone: HsCD00045548

Clone ID:HsCD00045548
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 164152
Original Clone ID FLH164152.01X
HIP Master Clone ID 137352

Property:

Collection: Breast Cancer 1000
Collection: HIP human pDONR221 set

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1389 Homo sapiens CLOSED MGC template 5914 RARA retinoic acid receptor, alpha
Insert1
Size (bp)1389
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceMGC template
Species Specific ID 5914
Gene SymbolRARA
Gene Nameretinoic acid receptor, alpha
Keyword

Insert Sequence:

ATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCGGTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCACCAGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCACCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACAACAGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAACTCTCCACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACCACCCTCACCATCGCCGACCAGATCACCCTCCTCAAGGCTGCCTGCCTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGACACCATGACCTTCTCGGACGGGCTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCCCTCACCGACCTGGTCTTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGGCGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGCTAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGGGGGCTGAGCGGGTGATCACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1853
Start on reference sequence 465

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCGGTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCACCAGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCACCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACAACAGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAACTCTCCACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACCACCCTCACCATCGCCGACCAGATCACCCTCCTCAAGGCTGCCTGCCTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGACACCATGACCTTCTCGGACGGGCTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCCCTCACCGACCTGGTCTTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGGCGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGCTAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGGGGGCTGAGCGGGTGATCACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 880
Date: 2016-06-23

Last Passing Sequencing Read:

>25455-19_HsCD00045548-M13F_C3 880 1410 31 934 NTTTAACGCATAGATTTATTTTACTGAAGTGACCTGTTCGTTGCACAAAT TGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT CCACCATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCAC CTCAATGGGTACCCGGTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCT GGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCACCAGCTTC CAGTTAGTGGATATAGCACACCATCCCCAGCCACCATTGAGACCCAGAGC AGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACC CCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACC ACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGC ATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCAT CAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCT TTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAG AAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCC GGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCT TCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACAACAGCTCAGAA CAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAACTCTC CACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCT TCACCACCCTCACCATCGCCGAACAGATCACCCTCCTCAAGGCTGCCTGC CTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGA CACCATGACCTTTCTCGACGGGCTGACCCTGAACCGACCNAGATGCACAC GCTGGCTTCGCCCCCTCACCGACTGGTCTTTTGCTCGNCAACAGCTGCTG CCCTGAAAATGATGATGCGAAAGGGGTTGCTCACGCATCTGCTCTCTGCG AAACCGCAAGACTTGAACACCGACCGGTGACTGCTCAGAACGCTCTGAGC CCTAGGTCACTGCGGAGCGAGCCAACCGCCCAATGTCCCAGAACTATAAA TCCGACTGCAACTACCCCAGGGCTAAGGGGATCCCTAATGAATCCGTTCC GCCCTCTCCGAATGTGAAATAAGCTGACTTACAACCGGGGGGGGGGAAAA GGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute