Clone: EvNO00438621 ← Click Here To Order

Clone ID:EvNO00438621
Is Verified:N
Status:AVAILABLE
Source:
Description:Lentiviral cDNA expression vector with ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; CRE-Lox recombinational or restriction enzyme cloning.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 821
Date: 2017-04-18

Last Passing Sequencing Read:

>27065-69_EvNO00438621-CMV-F_E9 821 1445 30 883 NNAACATGGCATTACGACTCGTTAGTGACCGTCAGATCGCCTGGAGACGC CATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCT CCGGCTAGCATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCA ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATAT TTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCC CGAAAAGTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGG TTTCCTTGACAATATCATACTTATCCTGTCCCTTTTTTTTCCACAGCTAC CGGTCCACCACCACCACCACCACTAAGGATCCGCGGCCGCAAATTCCGCC CCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAA GGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTT TGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTC CTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTC GTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGT AGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCT GCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCC CAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTC CTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATT GTATGGGATCTGATCTGGGGGCTCGGTGCACATGCTTTACATGTGTTTAG TCGAAGTTAAAAAAACGTCTAGGCCCCCCGACCCCGGGGACGTGGTTTTC CTTTGAAAAACACGATGATAAGCTTGGCACAACCATGGCCCAGGCCTTTG CTCAAGAAGAATCAACCCTCATTGGAAGAGCAACGGTTACAATCAACAGC ATCCCCATCTCTGAAAAATAAAGCGTCGCCAGCGCAGCTCTCTCTAAGGA ACGCCCATCTTCACGGTGGTCATGTATATCATTTAACGGGGGAACCTGTG CAAAACCCTGTTGTTGGGACTGGTGCTGTTGCGGAACTGGGAACCGACTT GATCGTCCCAATCGGAAGAAAACAGGGGCACTTTGACCCTGGGAAAGGGC CCACAGGGTTTCCCAATTGACTCCGGAATAAAGCAATGGAGGACAGGATG AACCCCCACGCCTGGAATTCGAAATCTCCCCTCGGTATGGGGGAGGCAAA ATCAATTCTAATTGTCCCCTTTCCAGGAAACACGTTAACCTCTAAAGAAT

Vector Information:

Vector Name:pCW45
Type:bacterial plasmid
Description:mammalian expression expression with cppt and CMV and LoxP and IRES and BlastR and WPRE and cPPT #2 and SV40 and AmpR and pBR322 and M13 reverse and T3 and psi and RRE; ampicillin resistance in bacterial, blasticidin resistance in mammalian, carbenicillin resistance in bacterial;
Properties:mammalian expression
Comments:
Map:pCW45-Map.pdf
Sequence:pCW45-DNA Sequence.dat
Size (bp):7388
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial carbenicillin
mammalian blasticidin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.