Clone: EvNO00438085 ← Click Here To Order

Clone ID:EvNO00438085
Is Verified:Y
Status:AVAILABLE
Source:
Description:Control hairpin designed to demonstrate positive infection via conferred puromycin resistance, but will not target a protein in human genome.
Comments:
Type:No insert
Verification Method:End Read Sequencing with Ash-LKO-R
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 803
Date: 2016-11-07

Last Passing Sequencing Read:

>26253-91_EvNO00438085-Ash-LkoR_C12 803 1303 79 896 TTTTTCCGCGCCTCNATCGAGACACGCCCGAGCAGCCGCGTCCCTGCGCA ACCCAGGGTCTGCCTTGGAAAAGGCGCAACCCCAACCCCCTCGAGCCGCG GCCAAAGTGGATCTCTGCTGTCCCTGTAATAAACCCGAAAATTTTGAATT TTTGTAATTTGTTTTTGTAATTCTTTAGTTTGTATGTCTGTTGCTATTAT GTCTACTATTCTTTCCCCTGCACTGTACCCCCCAATCCCCCCTTTTCTTT TAAAATTGTGGATGAATACTGCCATTTGTCTCGAGGTCGAGAATTCAAAA ACCTAAGGTTAAGTCGTTATCACTCATGGTTATGGCAGCACTGCATAATT CTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTAC TCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAG TGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTA CCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATC TTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAA GGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTG TCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTAAATTGTAAGCGTTA ATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTT AACAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACC GAGATAGGGTTGAGTGTTGTTTCAGTTTTGGAACAGAGTCCACTATTTAA GAACGTGGACTCCAACGTCAAAGGGCGAAAAAACGTCTATCAGGGCGATG GCCCACTACGTGAAACATCACCCTAATCAAGTTTTTTGGGGTCAAGGTGC GTTAAGCACTAAATCGGAACCTTAAGGGACCCCCGATTTAAAGCTGAAGG GAAAGCCGGCAAACTTGCGAAAAGGAAGGAAGAAAACNAAGGGACGGGCC CTAGGGCCTGGAAAGTTACGGTAACCTTCCGAAACCCCAACCCGCCCGTT AAAGCCCCTTAAGGGGCGTCCTTTCCCTTTGGTGCAAATTTTTGAAGGGA

Vector Information:

Vector Name:pLKO-scramble
Type:bacterial plasmid
Description:Control hairpin designed to demonstrate positive infection via conferred puromycin resistance, but will not target a protein in human genome.
Properties:viral production
Comments:
Map:pLKO.1-puro.jpg
Sequence:pLKO-scramble.txt
Size (bp):7095
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial carbenicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial Standard Carbenicillin - 100 in LB Standard Carbenicillin - 100 in LB