Clone: EvNO00438084

Clone ID:EvNO00438084
Is Verified:Y
Status:AVAILABLE
Source:
Description:Envelope plasmid used for lentivirus production. Mammalian expression of VSV-G driven by CMV promoter. Ampicillin resistance in bacteria. Map inferred from end read sequence and anecdotal information. Reference sequence is END READ ONLY.
Comments:
Type:No insert
Verification Method:End Read Sequencing with CMV-F
Distribution:Academic and non-profit labs
Special MTA:
Map:VSV-G.pdf

Related Identifiers:

Sequencing Information:

Phred Score: 763
Date: 2018-12-14

Last Passing Sequencing Read:

NAAAACAGTGACTTAGCGACTCGTTAGTGACCGTCAGATCGCCTGGAGAC GCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGC CTCCCCTCGAAGCTTACATGTGGTACCGAGCTCGGATCCTGAGAACTTCA GGGTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGG TTAAATTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACACATATTGAC CAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTT TAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTT CTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTA AAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCA TATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATT GCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTG GGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCAT GTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCT GTGTGCTGGCCCATCACTTTGGCAAAGAATTCATGGGCCAGACTGTTACC ACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGC TCACAACCAGTCGGTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCT CTGCAGAATGGCCAACCTTTATCGTCGGATGGCCGCGAGACGGCACCTTT GACCGAGACCTCATCACCCAAGTTAAGATCAAGGTCTTTTCACCTGTGCC GCATGGACACCCAGAACATGTCCCCTACATCGTGACCTGGCGAGCCTTTG GACTTTGACCCCCCTCCCTGGGTCAGCCCTGTGTAACCCTAAAGCTCAGC TCCTCTTCTCCATTCGGCCCGTTTTCCCCTTGAGCTTCTCGTTCGACCCG CCTCGATCCTCCTTAATCAACCTCACTCTTCTCTAGGGCAAACCTAACTC AGTTCTTCTGAAATGGGGGGCATCATTCACTCCTACTAACACCCCCGCTT TAGGTACCAGACCCCCCTTCGAACGGACGAATGGTGTAAACTACCCTGCG GAAAGACCGACCCCCCATGGTTTCCCTCTGGGAAAGGACCCCGGGCCCAC CCTACCGGGGTTCCCTCCGGAAAGAAAGAACTTAAGGGCTTCCCTTAATT AAGGGAAAAACCTTTTTGAGACGAAGAAATTTTGTTGTCCCCCCCCCGGA ATTTCTTGTTCTCTAAAAAAAGTGTTAAAATGGGGGAGAGCCCAATATAT

Vector Information:

Vector Name:VSV-G
Type:bacterial plasmid
Description:Envelope plasmid used for lentivirus production. Mammalian expression of VSV-G driven by CMV promoter. Ampicillin resistance in bacteria. Map inferred from end read sequence and anecdotal information. Reference sequence is END READ ONLY.
Properties:viral production
Comments:
Map:VSV-G.pdf
Sequence:VSV-G.txt
Size (bp):6363
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.