Clone: EvNO00438082 ← Click Here To Order

Clone ID:EvNO00438082
Is Verified:Y
Status:AVAILABLE
Source:
Description:Envelope plasmid used for lentivirus production. Mammalian expression of VSV-G driven by CMV promoter. Ampicillin resistance in bacteria.
Comments:
Type:No insert
Verification Method:End Read Sequencing with CMV-F
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 920
Date: 2017-07-05

Last Passing Sequencing Read:

>27516-57_EvNO00438082-CMV-F_A8 920 1443 35 980 NNNNTGTCAGTGGCATTACAACTCGTTAGTGACCGTCAGATCGCCTGGAG ACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCA GCCTCCCCTCGAAGCTGATCCTGAGAACTTCAGGGTGAGTCTATGGGACC CTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGG AAGGGGAGAAGTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTG CATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTT ATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGA TACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATA TAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAAT CCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATT CTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTT CCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACT TTGGCAAAGAATTCTGACACTATGAAGTGCCTTTTGTACTTAGCCTTTTT ATTCATTGGGGTGAATTGCAAGTTCACCATAGTTTTTCCACACAACCAAA AAGGAAACTGGAAAAATGTTCCTTCTAATTACCATTATTGCCCGTCAAGC TCAGATTTAAATTGGCATAATGACTTAATAGGCACAGCCTTACAAGTCAA AATGCCCAAGAGTCACAAGGCTATTCAAGCAGACGGTTGGATGTGTCATG CTTCCCAATGGGTCACTACTTGTGATTTCCGCTGGTATGGACCGAAGTAT ATAACACATTCCATCCGATCCTTTCACTCATCTGTAGAAACAATGCAGGA AAGCATTGAAACAAACGAAACAGGAACTTGGCTGAAATCAGGCTTNCCTC CNTCAAAGTGTGAATATGCACTGTGACGGATGCCGAAGCAGTGATTGTCC AGNTGACTCCCTCACATGTGCTGGTTGATGAATCACAGGAGAATGGGTTG ATTCACAGTCATCAACGGAAAATGCAGCATTANTATGCCCACTGTCATAA CTCTACACCTGGCATCTGACATTAAGTCAGGGGCTAGTGATTCACCTCAT TTCCTGGAACTACCTTCTTCCGAGGACGAAACATTCTCCTGGGAAGGAGC CAAGGGTCAAAATACTCTTTGCTTTAAAATGAGGCAGCCGCAATGCAACT GCAACTGGGGAAGAACCCCCCGGGTCTGTCAAAGAGTAAAGATTTTTTTT

Vector Information:

Vector Name:pHDMG
Type:bacterial plasmid
Description:Envelope plasmid used for lentivirus production. Mammalian expression of VSV-G driven by CMV promoter. Ampicillin resistance in bacteria.
Properties:viral production
Comments:
Map:pHDM-G.pdf
Sequence:pHDM-G.txt
Size (bp):6237
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.