Clone: HsCD00043345

Clone ID:HsCD00043345
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 171121
Original Clone ID FLH171121.01X
HIP Master Clone ID 144587

Property:

Collection: HIP human pDONR221 set

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 834 Homo sapiens CLOSED MGC template 3280 HES1 hairy and enhancer of split 1, (Drosophila)
Insert1
Size (bp)834
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceMGC template
Species Specific ID 3280
Gene SymbolHES1
Gene Namehairy and enhancer of split 1, (Drosophila)
Keyword

Insert Sequence:

ATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTAGCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTAG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1030
Start on reference sequence 197

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTAGCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute