Clone: EvNO00422231 ← Click Here To Order

Clone ID:EvNO00422231
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector. loxP, and GATEWAY recombination sites with MCS. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, p-transposase promoter with ftz intron and K10 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 810
Date: 2017-10-19

Last Passing Sequencing Read:

>28080-80_EvNO00422231-8-T7_H10 810 1391 45 829 NNNAAAGGAGCTCGACTGAGCGCGCCCTAGTTCCGTGAAATCAAGCATTT TCTAAATTAAATGTATTCTTATTATTATAGTTGTTATTTTTGATATATAT AAACAACACTATTATGCCCACCATTTTTTTGAGATGCATCTACACAAGGA ACAAACACTGGATGTCACTTTCAGTTCAAATTGTAACGCTAATCACTCCG AACAGGTCACAAAAAATTACCTTAAAAAGTCATAATATTAAATTAGAATA AATATAGCTGTGAGGGAAATATATACAAATATATTGGAGCAAATAAATTG TACATACAAATATTTATTACTAATTTCTATTGAGACGAAATGAACCACTC GGAACCATTTGAGCGAACCGAATCGCGCGGAACTAACGACAGTCGCTCCA AGGTCGTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACAG CGAAAGAGCAACTACGAAACGTGGTGTGGTGGAGGTGAATTATGAAGAGG GCGCGCGATTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTAT GTAGCGATAAACGAGTTTTTGATGTAAGGTATGCAGGTGTGTAAGTCTTT TGGTTAGAAGACAAATCCAAAGTCTACTTGTGGGGATGTTCGAAGGGGAA ATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGGCACAAATATAAT TACATTAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATAAT GGTAAAAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACTCCT TGCGTCGGGCCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTC ACGATGAGAATGGCCAGACCCACGTAGTCCAGCGGCAGATCGGCGGCNGA GAAGTTAAGCGTCTCCAGGATGACCTTGCCCGAACTTGGGCACGTGGTGT TCGACGATGTGCAGCTAATTTCGCCCGGCTCCACGTCCGCCCATTGGTAA TCAGCAGACCCTCGGTGGGCGTACGGACCATGAGAGGTACGACAACCTTT TGAGGTATACTGGCACCNGACCCCAGTTCAAGAGGAACCCGCCAAGAACA GGAATGTTAGATTACCGGCGGACCCACAACAGCCCATCAAGGTCAAGAAC TGCCGCCGTATTTAAAACCGAAGAACTTGACCCTTGGCCACCAATTGACA CCCCCGGCATTTAAAAATGAAACTTCCGCCCCAATCCAATCTCAAATGCA CCCCGTAAAACAGGGCCCTGGAAAAAACGGCATTCCAATCGTTTGCCAAA AAATGGTCCACCAAAATCCATTCGCCTCCTCAAAACGGGCCTCAGGGACC

Vector Information:

Vector Name:pWALIUM22
Type:bacterial plasmid
Description:Drosophila expression vector. loxP, and GATEWAY recombination sites with MCS. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, p-transposase promoter with ftz intron and K10 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Revised 4/25/2012
Map:WALIUM22_map_seq.pdf
Sequence:pWALIUM22.txt
Size (bp):11256
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
drosophila white

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.