Clone: EvNO00422230 ← Click Here To Order

Clone ID:EvNO00422230
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector. loxP, and GATEWAY recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, Hsp70 promoter with ftz intron and SV40 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 844
Date: 2017-11-28

Last Passing Sequencing Read:

>28181-83_EvNO00422230-3-T7_C11 844 1327 51 863 NNNNCCGCACTCGACTAGCGCGCCCAGTTCCGTGAATCCAGCATTTTCAA ATTAAATGTATTCTTATTATTATAGTTGTTATTTTTGATATATATAAACA ACACTATTATGCCCACCATTTTTTTGAGATGCATCTACACAAGGAACAAA CACTGGATGTCACTTTCAGTTCAAATTGTAACGCTAATCACTCCGAACAG GTCACAAAAAATTACCTTAAAAAGTCATAATATTAAATTAGAATAAATAT AGCTGTGAGGGAAATATATACAAATATATTGGAGCAAATAAATTGTACAT ACAAATATTTATTACTAATTTCTATTGAGACGAAATGAACCACTCGGAAC CATTTGAGCGAACCGAATCGCGCGGAACTAACGACAGTCGCTCCAAGGTC GTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACAGCGAAA GAGCAACTACGAAACGTGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCG CGATTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTATGTAGC GATAAACGAGTTTTTGATGTAAGGTATGCAGGTGTGTAAGTCTTTTGGTT AGAAGACAAATCCAAAGTCTACTTGTGGGGATGTTCGAAGGGGAAATACT TGTATTCTATAGGTCATATCTTGTTTTTATTGGCACAAATATAATTACAT TAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATAATGGTAA AAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACTCCTTGCGT CGGGCCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTCACGAT GAGAATGGCCAGACCCACGTAGTCCAGCGGCAGATCGGCGGCGGAGAAAG TAAGCGTCTCCAGGATGACCTTGCCCGAACTGGGGCACGTGGTGTTCGAC GATGTGCAGCTAATTTCGCCCGGCTCCACGTCCGCCCCATGGNTAATCAG CAGACCCTCGNTGGCGTAACGAACCATGAGNAGTACGAACACCATTGANG TATACTGGCACGAGCCCCGAGTTCAGAAGAAGCCCGCAAAAGCAGGAATG GTATGATAACCNNGCGACCCACAGACAGCGCATCAAGGTCAAGAGCTGGC GCAGAAAATAAATATCGAAANGACGTGACCATTGGCCACCAAATGACAAC CCCCAGGCATTAAAAGTGCACACTCCGGCCGCATTCGATATCGAAAAGAA TCCCCTGAAACAATTGCCCTGAAAAACACGCAATCGCAATCCTTTCCCAA

Vector Information:

Vector Name:pWALIUM20
Type:bacterial plasmid
Description:Drosophila expression vector. loxP, and GATEWAY recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, Hsp70 promoter with ftz intron and SV40 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Revised 4/25/2012
Map:WALIUM20_map_seq.pdf
Sequence:pWALIUM20.txt
Size (bp):10540
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
drosophila white

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.