Clone: EvNO00422227 ← Click Here To Order

Clone ID:EvNO00422227
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for Recombination cloning, Over-Expression (ROE). loxP, and GATEWAY recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html Two Gypsy insulators, two 5xUAS, Hsp70 promoter, with ftz intron and SV40 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 846
Date: 2016-12-02

Last Passing Sequencing Read:

>26372-44_EvNO00422227-M13F_D6 846 1448 31 853 NNNNAAAGATACTATAGGCGATTGGGTACAGCTTCACGACCTAGGCGCGC CCTAGTTCCAGTGAAATCCAAGCATTTTCTAAATTAAATGTATTCTTATT ATTATAGTTGTTATTTTTGATATATATAAACAACACTATTATGCCCACCA TTTTTTTGAGATGCATCTACACAAGGAACAAACACTGGATGTCACTTTCA GTTCAAATTGTAACGCTAATCACTCCGAACAGGTCACAAAAAATTACCTT AAAAAGTCATAATATTAAATTAGAATAAATATAGCTGTGAGGGAAATATA TACAAATATATTGGAGCAAATAAATTGTACATACAAATATTTATTACTAA TTTCTATTGAGACGAAATGAACCACTCGGAACCATTTGAGCGAACCGAAT CGCGCGGAACTAACGACAGTCGCTCCAAGGTCGTCGAACAAAAGGTGAAT GTGTTGCGGAGAGCGGGTGGGAGACAGCGAAAGAGCAACTACGAAACGTG GTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGATTTGAAAAGTATGTA TATAAAAAATATATCCCGGTGTTTTATGTAGCGATAAACGAGTTTTTGAT GTAAGGTATGCAGGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAGT CTACTTGTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATAGGTCATA TCTTGTTTTTATTGGCACAAATATAATTACATTAGCTTTTTGAGGGGGCA ATAAACAGTAAACACGATGGTAATAATGGTAAAAAAAAAAAACAAGCAGT TATTTCGGATATATGTCGGCTACTCCTTGCGTCGGGCCCGAAGTCTTAGA GCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGACCCAC GTAGTCCAGCGGCAGATCGGCGGNCGAGAAAGTAAGCGTCTCCAGAATGA CCTTGCCCGAAACTGGGCACGTGNTGTTCGACGATGTGCAGCTAATTTCG CCCGGCTCACGTCCGCCCATTGGTAATCAGCAGACCCTCGNTNNGCGTAC GAACCCATGAGAGTACGACACCATTTNGAGTAACTGNCACGAATCCGAGT CAGAAGAGCCGCCAAGAGCAGATGTATGATACCNGCGAACCACGACGCTC ATCAGTCAAGACTGCGCAGATTAGAATCGAAGACGTGACCTGGCCACAAT GACACCCCAGCATGAAAATCANCTCGNCCCATCGATCTCGATGCATCCTG AAACCAGGCCTGAAAAACGCAATCCATCTTCTCAAATATGTAGCAAAGAA ATGGCCCTCAAAAGGGCTAGGACCAACAATTTTAAAAAAATTAGAAGGTT ACACTTTTCCCCATTAAGTGTTGAAAAAATTTTATCCCCGTTTTTGAAAA

Vector Information:

Vector Name:pWALIUM10-roe
Type:bacterial plasmid
Description:Drosophila expression vector for Recombination cloning, Over-Expression (ROE). loxP, and GATEWAY recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two Gypsy insulators, two 5xUAS, Hsp70 promoter, with ftz intron and SV40 poly A. White selection marker in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA
Properties:drosophila in vitro and in vivo expression
Comments:To amplify this vector you will need to use One Shot ccdB Survival 2 T1R Competent Cells(Invitrogen Cat. No. A10460), or other gateway competent cells. Revised 4/25/2012
Map:WALIUM10roe_map_seq.pdf
Sequence:pWALIUM10-roe.txt
Size (bp):11556
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
drosophila white

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.