Clone: EvNO00422225 ← Click Here To Order

Clone ID:EvNO00422225
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for Recombination cloning, Over Expression (ROE). loxP, and GATEWAY recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, Hsp70 promoter, ftz intron, SV40 poly A, vermilion selection in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 367
Date: 2015-04-07

Last Passing Sequencing Read:

NGGGGGGCGGGAGCTTGGATATTTTGTTATGTTAATGTATTATATGTCAG ACATAAAGAAAAGGAACACATCAAATGTGATAACAAAGACTAAACAAGTA ATTTTATTACACCAAAACGACAAAACAGTAGGCAGAACAAACAACGCATA GCCAAACATTGACGAATTGGATACCCTGCCGATTGTCAGACACTTTTGTT GATCAGTTTCTTGCGAATGGTCTCGTCCAGCGGTGGAATCGCCTCGCGGG GAATCAGAAAAGTGGACAGATTGAACAGATCCAGAAACACCTTGTACCGA TCACTGAAACCAAAAAAAAACAAAGGGAGAACAGTTTGAGTTCATTGATC CCCGATANTATCACATCTGCGATGATCACCTGAGAGTGGAGCGCAGATAT TGATATCCAGACGAGCCACCAGTGCCCNACTGGTGGGATCCAATCATGCG TTGCACCATGATCACGTGATTGTCTTGCGCGGGAATAGAAAGTATTGGTT TAGAAAACCGTCTTAACNTAAGAATTTTTTTTAAAAAAGTTTCAAGAATG CAACCTTACATCCCCCCTTGTTTATACCAATCCATTCCCTGAACCGGGGA AACACTGGTGGGTTGGCTAAACCGGGTTCCCCCTAAAAAGGGATCTAAGG GTCCTTAAGGGCCATGGGAAACGGGAACCCCCCAACCCCCGGGTTCGGGC TTGGGAAAAAAAGGGGGAAAACCCCCCCTCCTTTTAATGCAAAGGGGGAA TTTTTTCCCTTTCCCGGCCCCCAGGGGTTTTTAATCGCCCCAAAAAAAAA ACCCCCTCAAAATGTCCCAAAAATAAAAACCCTCTTCAGGGGGGGCTCTC CCACCTTGTGTAATTCCCAAGAGGGGTTTTTCCCAGGAAAAAAATTCCCC CCCCTCCAAAAAAAAAAAATTTTTGGGTTTCCCCCCCGGTTAAAAACCCC TTTTGTTTAAAAAAGGGCCCCAAAAAAAAAGGGGGGGGGTTTGGAAAAAA AAAAAAGGGGGGGGTTCCAAGAGGTTTTCCCCCCCGGAAAAAAAAAAATT TTTTTGGAAAAAAAAATTTTTTTAAAAAAACCCCCGTTGATAAAACCCCG GTTTTTTCTCCCCCCCCCCCCGCGGGGAAAAAAAAAAATTAATCACCCGG GGGGGGGAAAAATTTTGTTTTTAAAAAACCCCCCGCGGGAAAAAAAAAGG GGGGTTTTCCCCCAAAAGAGNNNNAAAAAACAATTTTTTTTTGGGGGACC ACCTTTTTTTGTTAAAAAAAAAAAAAAATGGGGCGCCTCCCCCCAGAAGG AAAAAAACGGGGGGGGGGCGGCAAAAAAAAAACAAAAACTCGGGGGGGGG GGAAGAAAAAAAAAATACTCCCCCTCCCCCNNGGGGGGGCCCCGCCCCNA

Vector Information:

Vector Name:pVALIUM10-roe
Type:bacterial plasmid
Description:Drosophila expression vector for Recombination cloning, Over Expression (ROE). loxP, and GATEWAY recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Two gypsy insulators, two 5xUAS, Hsp70 promoter, ftz intron, SV40 poly A, vermilion selection in drosophila, AmpR in bacteria. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:To amplify this vector you will need to use One Shot ccdB Survival 2 T1R Competent Cells (Invitrogen Cat. No. A10460), or other GATEWAY competent cells. Revised 4/25/2012
Map:VALIUM10roe_map_seq.pdf
Sequence:pVALIUM10-roe.txt
Size (bp):9240
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial chloramphenicol
drosophila vermilion