Clone: EvNO00422224 ← Click Here To Order

Clone ID:EvNO00422224
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and GATEWAY recombination sites, NheI andEcRI method to clone shmiR. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html P-Trans promoter with ftz intron, two gypsy insulators,two 5xUAS, K10 localization element and vermilion selection in drosophila. AmpR in bacteria; vermilion marker in drosophila. Specialty sequencing primer required to verify insert. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 870
Date: 2017-12-18

Last Passing Sequencing Read:

>28181-53_EvNO00422224-5-T3_E7 870 1395 38 976 NNNNAACGGACTCGCGGTGTTGGTTGGCACACCAAAATATACTGTTGCCG AGCACAATTGATCGGCTAAATGGTATGGCAAGAAAAGGTATGCAATATAA TAATCTTTTATTGGGTATGCAACGAAAATTTGTTTCGTCAACGTATGCAA TATTCTTTATTAAAAGAGGGTATGCAATGTATTTTATTAAAAACGGGTAT GCAATATAATAATCTTTTATTGGGTATGCAACGAAAATTTGTTTCGTCAA AGTATGCAATATTTTTTATTAAAAGAGGGTATGCAATGTATTTTATTAAA AACGGGTATGCAATAAAAAATTATTTGGTTTCTCTAAAAAGTATGCAGCA CTTATTTTTTGATAAGGTATGCAACAAAATTTTACTTTGCCGAAAATATG CAATGTTTTTGCGAATAAATTCAACGCACACTTATTACGTGGCCACTGCA GCCAATCCGCCGCACCCTCAGCTCCAAAGCACGCATATGACCCGTGAGCA GGCAGAGAAACGCAGGCGGATAGGAGTCACTAGCGCAGTTCTGTATAGCC TGCACTATCAAGCCGAAGAGCTGGTAGATATTGATGAGCACATAGTTTCT GGTGGAGTGCATCCAGTCAACGCCGAACCAGGCCGGATACAGGAGCTCTC GATCCGGGCGAACGACCACGCGGACGCAACTCAAAGTAGTGCCAAATACG AAAATACTGGCAAAGGTGCGGAAAGTGCCCTGTGCGATATTCACTTCCTT CCTCAAGGCAGAAATCTCCTCGGGATCGCCCACCAGCCGGGCTCTAGCGT CCATGAGCCTTAGGAGAGAGCGAATCTCATGGAGCTGCTTCCTCACCATG TACACATTCGCAAACTTCAAATTGGCCACAATATCGGTAATAGTTATGGT CAGGTTCTCGCACAATCGGGCCATGTTGGTGGTGAACAGCAGCCTGGCCA GCAAGCTCAAGGGAAACAGCACGGTGACCCACCAGTTGACCGTTATGGAG TATACCACGTAAAGCAGGCTTGAAACGCCCGNAGGACGCATCAGGCCAGT GAGCTCCCAAACGCGCCAGTGTTAGTACACAGCACTGTGGGGTGTCAGTT TGAAATCCTCTGCTTCTCCATGTCTCGGTTACCTTTGGGCAATCCAGGGG TTCTATGGCTATAACTCTTGGAATACCAGTGATGCGCTTATACTTATAAT GGATTGTNGCCAAACTGTCGCTAAGTGCCTGGATTGAACCGTAGCCCAGG TAAGATCCCCAAAAAATTTCCAGGCCTTATTTTGGTGCAACCCCTTTTTG GGGATCTTCTTATGGGGAGGGAAGGTTTTAAAACACTTTATTTACCATGC

Vector Information:

Vector Name:pVALIUM22
Type:bacterial plasmid
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and GATEWAY recombination sites, NheI andEcRI method to clone shmiR. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html P-Trans promoter with ftz intron, two gypsy insulators,two 5xUAS, K10 localization element and vermilion selection in drosophila. AmpR in bacteria; vermilion marker in drosophila. Specialty sequencing primer required to verify insert. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Revised 4/25/2012
Map:VALIUM22_map_seq.pdf
Sequence:pVALIUM22.txt
Size (bp):8973
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
EB5-alpha N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
drosophila vermilion

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.