Clone: EvNO00422223 ← Click Here To Order

Clone ID:EvNO00422223
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and GATEWAY recombination sites, NheI andEcRI method to clone shmiR. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html Hsp70 promoter with ftz intron, two gypsy insulators, 5xUAS and vermilion selection in drosophila. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 884
Date: 2017-12-12

Last Passing Sequencing Read:

>28181-48_EvNO00422223-8-T7_H6 884 1376 35 941 NNNCCAGAATAGATGGATATTTTGTATGTTAATGTATTATATGTCAGACA TAAAGAAAAGGAACACATCAAATGTGATAACAAAGACTAAACAAGTAATT TTATTACACCAAAACGACAAAACAGTAGGCAGAACAAACAACGCATAGCC AAACATTGACGAATTGGATACCCTGCCGATTGTCAGACACTTTTGTTGAT CAGTTTCTTGCGAATGGTCTCGTCCAGCGGTGGAATCGCCTCGCGGGGAA TCAGAAAAGTGGACAGATTGAACAGATCCAGAAACACCTTGTACCGATCA CTGAAACCAAAAAAAAACAAAGGGAGAACAGTTTGAGTTCATTGATCCCC GATATAATCACATCTGCGATGATCACCTGAGAGTGGAGCGCAGATATTGA TATCCAGACGAGCCACCAGTGCCCAACTGTTGGGATCCAATCATGCGTTG CACCATGATCACGTGATTGTCTGCGGCGGGAATAGAAAGTATTTGGTTAG GAAAACCAGTCTTAAACATAAGATATATTTATAAAAGAGTATCAAAGAAT GCAATACTTACATCTCCACTTGGTTATTAACGAGTCGATGTCCATGAGCA GGGTGAGCAACTGGTGTGGTTGGCTGAACCTGGGTTCATCCCTATAGAAG GTGATCATGATGGCTCCCTGAAGGGCACGATGGCTAAACCGGCGATCCCC ACGACGCACCAGTGCATCGTGCACTGCCGGATCAAAGATGGAGCGATACA CCTCGCGTCGCTTCTCAATGTCCATGAGGCGGTAGTTTTTCGCCTTCTCC ACGGGCTCCTCCATGGCGCTCTGTACCTGCGCCTCCAGGAATCGATCGAC GCTCTCCTGAAACTTGGCCCAGAAGTTGAAGCCACTCTCCTCCAGTCCGG GCGTCCTCTCCAGCCATCGCTGCACTAGCTCCAGTAGCGAGGGATCTTTC TCCGAGTTGCGAATCGAGTTCCGCGCCTCCTCGTCGCTAAAGACATCCGA GTACTTCTGGTTGTATCTCACCCGCTGCTCTGTCAAAACTCCCAGCTTGA TCTCGATCAAACGGAACTGCAGCGACTGAAAAACCAAAGGCGGGGGCCAA GTACTTGCGGAAGTCCATGAAGTCCAGCGGGGTCCTGTTCTCCAAATTGG CCACTTGGGCCACACGAGCTTGTCCAGGGAGTTATTAACGGATTTTGGTA AAAATTCCAAAGCCCTCCTTTTAGAACCAAAACATCCGGTTCCGCCGCTG ACAATTCCCACGTCTTGGTTTCACCGAGAACCCCTGCCCCAACGTTTCCG ATAGAGCTCAACCCAAAGAATTGCTGAACCAAGTCTAAGGGTGGGGAAAG

Vector Information:

Vector Name:pVALIUM20
Type:bacterial plasmid
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and GATEWAY recombination sites, NheI and EcoRI method to clone shmiR. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Hsp70 promoter with ftz intron, two gypsy insulators, 5xUAS and vermilion selection in drosophila. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Revised 4/25/2012
Map:VALIUM20_map_seq.pdf
Sequence:pVALIUM20.txt
Size (bp):8190
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
insect cells vermilion

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.