Clone: EvNO00422222 ← Click Here To Order

Clone ID:EvNO00422222
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for high expression of hairpin insert. Hsp70 promoter with 5xUAS, two gypsy insulators, and two ftz introns. AmpR in bacteria; white marker in drosophila. loxP and GATEWAY recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 852
Date: 2017-02-15

Last Passing Sequencing Read:

>26611-8_EvNO00422222-M13F_H1 852 1340 32 861 NNTACATCGAATCTATAGGCGATTGGGTACAGCTTCACGACCTAGGCGCG CCCTAGTTCCAGTGAAATCCAAGCATTTTCTAAATTAAATGTATTCTTAT TATTATAGTTGTTATTTTTGATATATATAAACAACACTATTATGCCCACC ATTTTTTTGAGATGCATCTACACAAGGAACAAACACTGGATGTCACTTTC AGTTCAAATTGTAACGCTAATCACTCCGAACAGGTCACAAAAAATTACCT TAAAAAGTCATAATATTAAATTAGAATAAATATAGCTGTGAGGGAAATAT ATACAAATATATTGGAGCAAATAAATTGTACATACAAATATTTATTACTA ATTTCTATTGAGACGAAATGAACCACTCGGAACCATTTGAGCGAACCGAA TCGCGCGGAACTAACGACAGTCGCTCCAAGGTCGTCGAACAAAAGGTGAA TGTGTTGCGGAGAGCGGGTGGGAGACAGCGAAAGAGCAACTACGAAACGT GGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGATTTGAAAAGTATGT ATATAAAAAATATATCCCGGTGTTTTATGTAGCGATAAACGAGTTTTTGA TGTAAGGTATGCAGGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAG TCTACTTGTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATAGGTCAT ATCTTGTTTTTATTGGCACAAATATAATTACATTAGCTTTTTGAGGGGGC AATAAACAGTAAACACGATGGTAATAATGGTAAAAAAAAAAAACAAGCAG TTATTTCGGATATATGTCGGCTACTCCTTGCGTCGGGCCCGAAGTCTTAG AGCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGACCCA CGTAGTCCAGCGGCAGATCGGCGGCGGAGAAAGTAAGCGTCTCCAGAATG ACCTTTGCCGAACTGGGGCACGTGGTGTTCGACGATGTGCAGCTAATTTC GCCCNGCTCACGTCCGCCCATTGGNTAATCAGCAGACCCTCGTTTGGCGT ACGAANCCATGAGAGTACGACNACCATTTGAGTATACTGGCACGGAGCCC GAAGTTCAGAAGAAGCCGCCNAAGAAGCAGAATGGTATTGATACCGGCGG ACCCACGACAGCGCCATCNAGNTCAAGGAGCTGNCCCACGAAATTAAAAT CCCAAGGAACTTGACCCATGGCCCCCAAAAGACCACCCCCAGCCATTAAA AAAATGANAACTCGGCCCCCANTCCATATTCGAAAAGGAAATCCCCGAAA

Vector Information:

Vector Name:pWALIUM10
Type:bacterial plasmid
Description:Drosophila expression vector for high expression of hairpin insert. Hsp70 promoter with 5xUAS, two gypsy insulators, and two ftz introns. AmpR in bacteria; white marker in drosophila. loxP and GATEWAY recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:To amplify this vector you will need to use One Shot ccdB Survival 2 T1R Competent Cells(Invitrogen Cat. No. A10460), or other gateway competent cells. Revised 4/25/2012
Map:WALIUM10_map_seq.pdf
Sequence:pWALIUM10.txt
Size (bp):13426
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial chloramphenicol
insect cells white