Clone: EvNO00422221 ← Click Here To Order

Clone ID:EvNO00422221
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and attB recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html Hsp70 promoter with ftz intron and gypsy insulator. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 873
Date: 2017-11-29

Last Passing Sequencing Read:

>27183-64_EvNO00422221-M13F_H8 873 1403 34 897 NNNAACTGCATACAATAGGCGATTGGGTACAGCTTGGATTTATTTTGTTA TGTTATATGTATTATATGTCAGACATAAAGAAAAGGAACACATCAAATGT GATAACAAAGACTAAACAAGTAATTTTATTACACCAAAACGACAAAACAG TAGGCAGAACAAACAACGCATAGCCAAACATTGACGAATTGGATACCCTG CCGATTGTCAGACACTTTTGTTGATCAGTTTCTTGCGAATGGTCTCGTCC AGCGGTGGAATCGCCTCGCGGGGAATCAGAAAAGTGGACAGATTGAACAG ATCCAGAAACACCTTGTACCGATCACTGAAACCAAAAAAAAACAAAGGGA GAACAGTTTGAGTTCATTGATCCCCGATATAATCACATCTGCGATGATCA CCTGAGAGTGGAGCGCAGATATTGATATCCAGACGAGCCACCAGTGCCCA ACTGTTGGGATCCAATCATGCGTTGCACCATGATCACGTGATTGTCTGCG GCGGGAATAGAAAGTATTTGGTTAGGAAAACCAGTCTTAAACATAAGATA TATTTATAAAAGAGTATCAAAGAATGCAATACTTACATCTCCACTTGGTT ATTAACGAGTCGATGTCCATGAGCAGGGTGAGCAACTGGTGTGGTTGGCT GAACCTGGGTTCATCCCTATAGAAGGTGATCATGATGGCTCCCTGAAGGG CACGATGGCTAAACCGGCGATCCCCACGACGCACCAGTGCATCGTGCACT GCCGGATCAAAGATGGAGCGATACACCTCGCGTCGCTTCTCAATGTCCAT GAGGCGGTAGTTTTTCGCCTTCTCCACGGGCTCCTCCATGGCGCTCTGTA CCTGCGCCTCCAGGAATCGATCGACGCTCTCCTGAAAACTGGCCCAGAAG TTGAAGCCACTCTCCTCCAGTCCGGGCGTCCTCTCAGACATCGCTGCACT AGCTCCAGTAGCGAGGGATCTTTCTCCGAGNTGCGAATCGAGTTCCGCGC CTCCTCGTCGCTAAAGACATCCGAGTACTTCTGGNTGTATCTCACCCGCT GCTCTGACAGAACTCCAAGCTTGNATCTCGATCAAACGGAACTGCAGCGA CTGAAAACCCAATGCGGGGGCCAGGTACTTGCGGAATCCATGAAGTCCTA CGGGTTCTGGTCTCCGAAAGGGCCCCTGGTCACCAGGAGCTGTACAAGGA GTTTAACCGGATTTGGTAAGAATTTCAAAACCTCCCTTTAAAACCAAACC CTCGGTCAATCCCTGGAATCTCCGCGCTTGGTTCCCAAGACCCCGATCCA AAGTTTCGGAGGATCCACCTCAAAAAATGCCTAACCAACTCTCAGCGGGG AAAGATTAAACGCTTGGGGTGCCCAAGGGAACACAACCCGCGGCGGAAGA

Vector Information:

Vector Name:pVALIUM10
Type:bacterial plasmid
Description:Drosophila expression vector for high expression of hairpin insert. loxP, and attB recombination sites. Detailed procedure for small scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Hsp70 promoter with ftz intron and gypsy insulator. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:To amplify this vector you will need to use One Shot ccdB Survival 2 T1R Competent Cells(Invitrogen Cat. No. A10460), or other gateway competent cells. Revised 4/25/2012
Map:VALIUM10_map_seq.pdf
Sequence:pVALIUM10.txt
Size (bp):11143
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DB3.1 T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
bacterial chloramphenicol
insect cells vermilion