Clone: HsCD00042008

Clone ID:HsCD00042008
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 191770
Original Clone ID FLH191770.01L
HIP Master Clone ID 166714

Property:

Collection: HIP human pDONR221 set
Collection: Kinase

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1053 Homo sapiens FUSION MGC template 1459 CSNK2A2 casein kinase 2, alpha prime polypeptide
Insert1
Size (bp)1053
SpeciesHomo sapiens
FormatFUSION
Tissue SourceMGC template
Species Specific ID 1459
Gene SymbolCSNK2A2
Gene Namecasein kinase 2, alpha prime polypeptide
Keyword

Insert Sequence:

ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGGAGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATCACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAGAAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAACGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGATCTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATGGAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCTGTGCTTTCCAGTGGTCTCACGGCAGCACGATTG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1078
Start on reference sequence 26

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGGAGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATCACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAGAAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAACGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGATCTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATGGAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCTGTGCTTTCCAGTGGTCTCACGGCAGCACGATTGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 883
Date: 2015-11-09

Last Passing Sequencing Read:

NNNAAACTTNNNNNNNNAACGCATAGATTTATTTGACTGATGTGACCGNTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGGAGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATCACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAGAAGTATCACATAGACCTAGATCCACACTTNCACGATATCCTGNNGACACATTCACGGAAACGCTGGNAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGATCTTCTGGACNAACTTCTGCGATACGACCATTCACAGAGACTGACTGCAAAAGAGGCATGGAGCACCATACTTCTACCCTGTGNTGAGGAGCAGTCCAGGCTTGTGCGGACATGCTGTGCTTTCAGTGGTCTCCCGCAGCCCAATGGAACAACTTTTCTGGTAAAAGTTGCAATAAAAGAAACATTGCTTAACATTTGTTTGCACAAAAGGTCCTTTTCGTCCAAAAAAATCTTATTTCCCCCCCGGGAATCCCTAAGGGGGGGCAATAAAGGGCAAAGTGTTTCTGGGAACTTGGCCCGGTCAAAATCTTATGGTTTTTGGCCAAAAAAATT

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute