Clone: HsCD00040951

Clone ID:HsCD00040951
Is Verified:Y
Status:AVAILABLE
Source:HIP
Description:
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

HIP Clone ID 182187
Original Clone ID FLH182187.01L
HIP Master Clone ID 157131

Property:

Collection: HIP human pDONR221 set

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 1410 Homo sapiens FUSION MGC template 5425 POLD2 polymerase (DNA directed), delta 2, regulatory subunit 50kDa
Insert1
Size (bp)1410
SpeciesHomo sapiens
FormatFUSION
Tissue SourceMGC template
Species Specific ID 5425
Gene SymbolPOLD2
Gene Namepolymerase (DNA directed), delta 2, regulatory subunit 50kDa
Keyword

Insert Sequence:

ATGTTTTCTGAGCAGGCTGCCCAGAGGGCCCACACTCTACTGTCCCCACCATCAGCCAACAATGCCACCTTTGCCCGGGTGCCAGTGGCAACCTACACCAACTCCTCACAACCCTTCCGGCTAGGAGAGCGCAGCTTTAGCCGGCAGTATGCCCACATTTATGCCACCCGCCTCATCCAAATGAGACCCTTCCTGGAGAACCGGGCCCAGCAGCACTGGGGCAGTGGAGTGGGAGTGAAGAAGCTGTGTGAACTGCAGCCTGAGGAGAAGTGCTGTGTGGTGGGCACTCTGTTCAAGGCCATGCCGCTGCAGCCCTCCATCCTGCGGGAGGTCAGCGAGGAGCACAACCTGCTCCCCCAGCCTCCTCGGAGTAAATACATACACCCAGATGACGAGCTGGTCTTGGAAGATGAACTGCAGCGTATCAAACTAAAAGGCACCATTGACGTGTCAAAGCTGGTTACGGGGACTGTCCTGGCTGTGTTTGGCTCCGTGAGAGACGACGGGAAGTTTCTGGTGGAGGACTATTGCTTTGCTGACCTTGCTCCCCAGAAGCCCGCACCCCCACTTGACACAGATAGGTTTGTGCTACTGGTGTCCGGCCTGGGCCTGGGTGGCGGTGGAGGCGAGAGCCTGCTGGGCACCCAGCTGCTGGTGGATGTGGTGACGGGGCAGCTTGGGGACGAAGGGGAGCAGTGCAGCGCCGCCCACGTCTCCCGGGTTATCCTCGCTGGCAACCTCCTCAGCCACAGCACCCAGAGCAGGGATTCTATCAATAAGGCCAAATACCTCACCAAGAAAACCCAGGCAGCCAGCGTGGAGGCTGTTAAGATGCTGGATGAGATCCTCCTGCAGCTGAGCGCCTCAGTGCCCGTGGACGTGATGCCAGGCGAGTTTGATCCCACCAATTACACGCTCCCCCAGCAGCCCCTCCACCCCTGCATGTTCCCGCTGGCCACTGCCTACTCCACGCTCCAGCTGGTCACCAACCCCTACCAGGCCACCATTGATGGAGTCAGATTTTTGGGGACATCAGGACAGAACGTGAGTGACATTTTCCGATACAGCAGCATGGAGGATCACTTGGAGATCCTGGAGTGGACCCTGCGGGTCCGTCACATCAGCCCCACAGCCCCTGACACTCTAGGTTGTTACCCCTTCTACAAAACTGACCCGTTCATCTTCCCAGAGTGCCCGCATGTCTACTTTTGTGGCAACACCCCCAGCTTTGGCTCCAAAATCATCCGAGGTCCTGAGGACCAGACAGTGCTGTTGGTGACTGTCCCTGACTTCAGTGCCACGCAGACCGCCTGCCTTGTGAACCTGCGCAGCCTGGCCTGCCAGCCCATCAGCTTCTCGGGCTTCGGGGCAGAGGACGATGACCTGGGAGGCCTGGGGCTGGGCCCCTTG

Insert Property: Insert 1

Type Value Extra Information
End on reference sequence 1498
Start on reference sequence 89

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTTTTCTGAGCAGGCTGCCCAGAGGGCCCACACTCTACTGTCCCCACCATCAGCCAACAATGCCACCTTTGCCCGGGTGCCAGTGGCAACCTACACCAACTCCTCACAACCCTTCCGGCTAGGAGAGCGCAGCTTTAGCCGGCAGTATGCCCACATTTATGCCACCCGCCTCATCCAAATGAGACCCTTCCTGGAGAACCGGGCCCAGCAGCACTGGGGCAGTGGAGTGGGAGTGAAGAAGCTGTGTGAACTGCAGCCTGAGGAGAAGTGCTGTGTGGTGGGCACTCTGTTCAAGGCCATGCCGCTGCAGCCCTCCATCCTGCGGGAGGTCAGCGAGGAGCACAACCTGCTCCCCCAGCCTCCTCGGAGTAAATACATACACCCAGATGACGAGCTGGTCTTGGAAGATGAACTGCAGCGTATCAAACTAAAAGGCACCATTGACGTGTCAAAGCTGGTTACGGGGACTGTCCTGGCTGTGTTTGGCTCCGTGAGAGACGACGGGAAGTTTCTGGTGGAGGACTATTGCTTTGCTGACCTTGCTCCCCAGAAGCCCGCACCCCCACTTGACACAGATAGGTTTGTGCTACTGGTGTCCGGCCTGGGCCTGGGTGGCGGTGGAGGCGAGAGCCTGCTGGGCACCCAGCTGCTGGTGGATGTGGTGACGGGGCAGCTTGGGGACGAAGGGGAGCAGTGCAGCGCCGCCCACGTCTCCCGGGTTATCCTCGCTGGCAACCTCCTCAGCCACAGCACCCAGAGCAGGGATTCTATCAATAAGGCCAAATACCTCACCAAGAAAACCCAGGCAGCCAGCGTGGAGGCTGTTAAGATGCTGGATGAGATCCTCCTGCAGCTGAGCGCCTCAGTGCCCGTGGACGTGATGCCAGGCGAGTTTGATCCCACCAATTACACGCTCCCCCAGCAGCCCCTCCACCCCTGCATGTTCCCGCTGGCCACTGCCTACTCCACGCTCCAGCTGGTCACCAACCCCTACCAGGCCACCATTGATGGAGTCAGATTTTTGGGGACATCAGGACAGAACGTGAGTGACATTTTCCGATACAGCAGCATGGAGGATCACTTGGAGATCCTGGAGTGGACCCTGCGGGTCCGTCACATCAGCCCCACAGCCCCTGACACTCTAGGTTGTTACCCCTTCTACAAAACTGACCCGTTCATCTTCCCAGAGTGCCCGCATGTCTACTTTTGTGGCAACACCCCCAGCTTTGGCTCCAAAATCATCCGAGGTCCTGAGGACCAGACAGTGCTGTTGGTGACTGTCCCTGACTTCAGTGCCACGCAGACCGCCTGCCTTGTGAACCTGCGCAGCCTGGCCTGCCAGCCCATCAGCTTCTCGGGCTTCGGGGCAGAGGACGATGACCTGGGAGGCCTGGGGCTGGGCCCCTTGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAATAATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 838
Date: 2016-05-18

Last Passing Sequencing Read:

NNNTTGGCGCATATGATTATTTTGACTGAAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTTTTCTGAGCAGGCTGCCCAGAGGGCCCACACTCTACTGTCCCCACCATCAGCCAACAATGCCACCTTTGCCCGGGTGCCAGTGGCAACCTACACCAACTCCTCACAACCCTTCCGGCTAGGAGAGCGCAGCTTTAGCCGGCAGTATGCCCACATTTATGCCACCCGCCTCATCCAAATGAGACCCTTCCTGGAGAACCGGGCCCAGCAGCACTGGGGCAGTGGAGTGGGAGTGAAGAAGCTGTGTGAACTGCAGCCTGAGGAGAAGTGCTGTGTGGTGGGCACTCTGTTCAAGGCCATGCCGCTGCAGCCCTCCATCCTGCGGGAGGTCAGCGAGGAGCACAACCTGCTCCCCCAGCCTCCTCGGAGTAAATACATACACCCAGATGACGAGCTGGTCTTGGAAGATGAACTGCAGCGTATCAAACTAAAAGGCACCATTGACGTGTCAAAGCTGGTTACGGGGACTGTCCTGGCTGTGTTTGGCTCCGTGAGAGACGACGGGAAGTTTCTGGTGGAGGACTATTGCTTTGCTGACCTTGCTCCCCAGAAGCCCGCACCCCCACTTGACACAGATAGGTTTGTGCTACTGGTGTCCGGCCTGGGCCTGGGTGGCGGTGGAGGCGAGAGCCTGCTGGGCACCCAGCTGCTGGTGGATGTGGTGACGGGGCAGCTTGGGGACGAANGGGAGCAGTGCAGCGCCGCCCACGTCTCCCGGGTTATCCTCGCTGGCAACCTCCTCAGCCACAGCACCCAGAGCAGGGATTCTATCAATAAGGCCAAATACCTCACCAAGAAACCCAGGCAGCCAGCGTGGAGGCTGTTAAATGCTGGATGAGATCCTCCTGCAACTGACCGCCTCAGTGCCCGTGGACGTGATGCCAGCCGAGTTTGATCCCACAATTACACGCTCCCCAACAGCCCTCCACCCCTGAAGTTCCCGCTGGCACTGCTAATCCAGCTTCAATTGGTCACAACCCCTACAGGCCACATGATGAATTCAATTTTGGGAATTCAGACAAACGGGATGAATTTTCGAACACAACTGGAGATCCTTGAAATCCGGAGGACCTGGGGTCCTTAATAACCACAAACCCGGAATTTAGTGTACCCTTTAAAAATGACCGTTTCTTCCAAAGGCCCATTCATTTTGGCACCCCCCTTTGTCCAATCTCAAGCCAAAAAAAAGTTTTGAATTCCAATTTGCCAAAACCTCTTGAACTAACGTTTGCCCAAATTTTGTTGGAAAAAACCGAGCGGGGCGCTCCCCTTTTAAGGTTAAAATCTTTTGCAACACCAAAAATTCCCACCCGAATATGATTCTCCCCTTCTTTAAATAAATCTTAGGGNNNNNNNNTAAAGGNNNNNAGAAAATATACCATATTNNNNN

Vector Information:

Vector Name:pDONR221
Type:bacterial plasmid
Description:Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Properties:Gateway, donor (entry), recombinational cloning
Comments:The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Map:pdonr221_pdonrzeo_map.pdf
Sequence:pDONR221_FASTA.txt
Size (bp):4762
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant Y

Antibiotic Selections:

Host Type Marker
bacterial kanamycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 50ug/mL kanamycin Growth with the single antibiotic in LB at 37 degrees is recommended. Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.

Authors:

Author Name Author Type
HIP Academic Institute