Clone: EvNO00401221 ← Click Here To Order

Clone ID:EvNO00401221
Is Verified:N
Status:AVAILABLE
Source:DRSC
Description:Drosophila expression vector for high expression of hairpin insert MCS, loxP, and attB recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrni.org/TRiP-HOME.html Hsp70 promoter with white and ftz intron. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Comments:
Type:No insert
Verification Method:
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 936
Date: 2016-10-20

Last Passing Sequencing Read:

NNNGGCAGGCATACCTCATAAGGGACAAAGCTGGAGCTCTGGAACCAGAC ATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTG AAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAA CCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTCCATTCATTTT ATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAA CCTCTACAAATGTGGTATGGCTGATTATGATCTCTAGTCAAGGCACTATA CATCAAATATTTTTCCATAATTTTCTTGTATAGCAGTGCAGCTTTTTCCT TTGTGGTGTAAATAGCAAAGCAAGCAAGAGTTCTATTACTAAACACAGCA TGACTCAAAAAACTTAGCAATTCTGAAGGAAAGTCCTTGGGGTCTTCTAC CTTTCTCTTCTTTTTTGGAGGAGTAGAATGTTGAGAGTCAGCAGTAGCCT CATCATCACTAGATGGCATTTCTTCTGAGCAAAACAGGTTTTCCTCATTA AAGGCATTCCACCACTGCTCCCATTCATCAGTTCCATAGGTTGGAATCTA AAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAA ATTTTATATTTACCTTAGAGCTTTAAATCTCTGTAGGTAGTTTGTCCAAT TATGTCACACCACAGAAGTAAGGTTCCTTCACAAAGATCCCGCGGCTCTA GTTCTTTGCAATCTGTAAGCATAAGCAAAGAAAAAATGGGTTAGCTAATG AGTTTTATAACTGCGTATTATTTGAAAATATCAAAAATGTATACAAAAAC ATATTTTCAATATTTTCAAAGTGTATTTTTAGGGGTTGTTAATCGTGTGT GATGCCTACCTGATGCCAACAATTGTCTAGCAGATCTGCATATGTTCTAG ATGCTAGCTGAGTTTTCAATTGGTAATTGAACCCTTCANNTAGATTCACA CAGATCAGCCGACTGCGAATAGAAACTCACCTAGGCACTAGTAGCGGCCG CTGAATTCCCAATCCNNTATCAGAAGTCTCTTTCTGTATCATAANTTACT CNTGNCAGATTNCAGTAGTGCAGTGAATTTACTGNTGCTGNTACTTTAAN NTGATCCTTNNACTGCACTTACTGCAAATGTNNNACTGTCACTGCGCTGT TATTTGCTACTTCGCTACCACGGTTCACTGCTGNTAAATGAATGCCCTCC GAAAAACCCCCCATTAACTCCGGGCTCTTTCAAAAATCCCTCCAGAAAAT TCCCCGAGAAGACTCCCTGAAAAAACTCCTGAAGAAACCCTCAAGAAACC CACCGGACAATTTTAAAAATTAAAATACGGAATCCCGAAAAACCCCGAAA

Vector Information:

Vector Name:pVALIUM1
Type:bacterial plasmid
Description:Drosophila expression vector for high expression of hairpin insert MCS, loxP, and attB recombination sites. Detailed procedure for smal scale cloning can be found on the TRiP website: http://flyrnai.org/TRiP-HOME.html Hsp70 promoter with white and ftz intron. AmpR in bacteria; vermilion marker in drosophila. Vector may recombine in bacteria and should be stored as DNA.
Properties:drosophila in vitro and in vivo expression
Comments:Revised 4/25/2012
Map:VALIUM1_map_seq.pdf
Sequence:pVALIUM1.txt
Size (bp):6742
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
drosophila vermilion

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.