Clone: EvNO00401203 ← Click Here To Order

Clone ID:EvNO00401203
Is Verified:N
Status:AVAILABLE
Source:
Description:Mammalian expression vector for use in lentiviral work. LoxP site cloning. Fusion format inserts will be expressed with HA-Flag tag that can be systematically removed during protein purification with TEV and EK cleavage. Viral components on vector improve expression. Ampicillin resistance in bacterial cultures, blasticidin resistance in mammalian cell lines.
Comments:
Type:No insert
Verification Method:end read sequencing with CMV-F
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 857
Date: 2015-06-11

Last Passing Sequencing Read:

CNNGGGGCATTNCAGAGCNGTTAGTGAACCGGTCAGATCGCCTGGAGAATTGGCTAGCGGCATAATACGACTCACTATAG GGTTTAAACTTAATTAAGCACCATGTACCCCTACGACGTGCCCGACTACGCCGAAAACCTATACTTCCAATCACTGCAGG ACTACAAGGACGACGATGACAAGGTCGACATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGA AGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCG CACATTTCCCCGAAAAGTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATCATAC TTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCCACCACCACCACCACCACTAACCCGGGGGATCCGGGGTTGGGGTT GCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGGGCGTGGTTCCGGGAAACGCAGCGGCGCCG ACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGCAGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCG ACGCTTCCTGCTCCGCCCCTAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACG TCTCACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCTGTGGCCAATAGCG GCTGCTCAGCAGGGCGCGCCGAGAGCAGCGGCCGGNAAGGGGCGGTGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCC CTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCANGTCCGGCAGNTCGGCTCCCTCGTTGACCGA AATCACCGACCTCTNTCCCCCNGCAATTCNCCNTGGTCTANACTGGNACAANAAGCAAAGTCNNTAAACGGAACCTCTGG GAATTACTNCAANGGGGGNCGGGNATCNAAGGCCTGGACNACAAGGAAAACTCNCNTCAAAANGCTGGGAAGNTGGACNA CCCTACCCTNGTTCTGGNCNNNGGAANAANNANGNGGGCCCNGGNCNCNATGCCCNTGGCCAANNCGNGANGGNTGGAAN GGNNTTATANCCCNCTTTTGGCCCCTGGAAGGGAANTTTGGGNNAAAAANTTTTGGGGAAAAACNCCNAGTNTTNCNNCT TGGGTCCCNTNCCATNGGGGGGGNCTAANNNNNCCCCGCCCCCCCCAAAAAAAAACGTNAAAACCCGGAAACNTNNGNTT NTGGNNAAAGGTTNCCNTGAAAAAANNNNNCCTTNCCCNGGGCCNTTNNGGGGGGNTGGGNAAGGNNCNNTNAAAAAAAA AAACCCCCCTTTTCCCCTTAAAAANTNTTCCCGGG

Vector Information:

Vector Name:pCW63
Type:bacterial plasmid
Description:Mammalian expression vector for use in lentiviral work. LoxP site cloning. Fusion format inserts will be expressed with HA-Flag tag that can be systematically removed during protein purification with TEV and EK cleavage. Viral components on vector improve expression. Ampicillin resistance in bacterial cultures, blasticidin resistance in mammalian cell lines.
Properties:mammalian expression
Comments:
Map:pCW63-T7-Tag.pdf
Sequence:pCW63.txt
Size (bp):7520
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
mammalian blasticidin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL ampicillin Growth with the single antibiotic in LB at 37 degrees is recommended. Commonly used conditions for ampicillin resistant plasmid clones.