Clone: EvNO00401201 ← Click Here To Order

Clone ID:EvNO00401201
Is Verified:Y
Status:AVAILABLE
Source:
Description:Mammalian expression vector for lentiviral work. Fusion format inserts are expressed with self excising fluorescent marker mRFP. LoxP cloning system. Viral components on backbone help expression. Ampicillin resistance in bacterial cultures, blasticidin resistance in mammalian cell lines.
Comments:
Type:No insert
Verification Method:end read sequencing with CMV-F
Distribution:Academic and non-profit labs
Special MTA:

Related Identifiers:

Sequencing Information:

Phred Score: 863
Date: 2015-06-11

Last Passing Sequencing Read:

CNGGGNCNTAGCAGACTGGTTAGTGACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACA CCGGGACCGATCCAGCCTCCGGCTAGCATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAG CATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCA CATTTCCCCGAAAAGTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATCATACTT ATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCCACCACCACCACCACCACTAAGGATCCGCGGCCGCAAATTCCGCCCC TCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTC CACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTT CCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACA ACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATA AGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCT CAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACA TGCTTTACATGTGTTTAGTCGAGGTNAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACA CGATGATAAGCTTGCCACANCATGGCCANNCTTTGTCTCAAGAAAATCCCCCTCATGGAAAGAGCACGGNTAAATCAANA GCATCCCATNTCTGAAANTANAGNGTCNCCNGGCANCTTTTCTAGGGACGGCGCATCTNCANGGGGNCAANGANATCATT TNACNGGGGAACTTGGNNAAANTCNGGGGNTGGGACTGNTGNTGNTGNGNAANTGGAANTNGANTGTATNNCCNNATCGA AAGAAAAAGGGGNNTTNGANCCCNGGGGANGGGCCNAAGGGGNTNCNNATTGNNCNGGGGTNAACCCNNNGANGANNNNN GGNNCCCCNNNNNNGGGATNNNAANNNCCCCCCNNNTNNGGGGGGNAAAAAANNNCCNNNATTTTNNCNTTANNNGGGGA NNNANANCCNGGCCCCNNNGGGGGGNTTTTNNANNAAANNNAAAAANCCCCCCCCCCNNTTTTNTTNNNGGGGGNNNNNN NNNNNNNNGGGGNNNCCCCCCCCCCCCCCCCCCCCCN

Vector Information:

Vector Name:pWE-p2A-mRFP
Type:bacterial plasmid
Description:Mammalian expression vector for lentiviral work. Fusion format inserts are expressed with self excising fluorescent marker mRFP. LoxP cloning system. Viral components on backbone help expression. Ampicillin resistance in bacterial cultures, blasticidin resistance in mammalian cell lines.
Properties:mammalian expression
Comments:
Map:pCW45-2A-mRFP.pdf
Sequence:pCW45-2A-mRFP.txt
Size (bp):8144
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
DH5-alpha T1 phage resistant N

Antibiotic Selections:

Host Type Marker
bacterial ampicillin
mammalian blasticidin