Clone: HsCD00399368

Clone ID:HsCD00399368
Is Verified:Y
Status:AVAILABLE
Source:The ORFeome Collaboration
Description:Synthetic construct Homo sapiens clone IMAGE:100069240, MGC:199251 hairy and enhancer of split 1, (Drosophila) (HES1) mRNA.
Comments:
Type:cDNA
Verification Method:Sequence Verification
Distribution:No restriction
Special MTA:
Map:

Related Identifiers:

GenBank Accession BC172546
Gene ID 3280
Gene Symbol HES1
GI 225000905
IMAGE ID 100069240
MGC ID 199251
Original Clone ID 100069240

Property:

Collection: MGC
Collection: OCAB
Collection: The ORFeome Collaboration

Insert Information:

Insert Size (bp) Species Format Tissue Source Species Specific ID Gene Symbol Gene Name Keyword
1 843 Homo sapiens CLOSED DNA template 3280 HES1 Homo sapiens hairy and enhancer of split 1, (Drosophila) (HES1), mRNA.
Insert1
Size (bp)843
SpeciesHomo sapiens
FormatCLOSED
Tissue SourceDNA template
Species Specific ID 3280
Gene SymbolHES1
Gene NameHomo sapiens hairy and enhancer of split 1, (Drosophila) (HES1), mRNA.
Keyword

Insert Sequence:

ATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTAA

Insert Property: Insert 1

Type Value Extra Information
3 Prime Linker Sequence TAAGGCCTCATGGgcccagctttcttg
5 Prime Linker Sequence gtacaaaaaagcagaagGGCCGTCAAGGCCCACC
CDS Start 1
CDS Stop 843

Inferred Whole Plasmid Sequence: (BETA)
Insert green, Vector black

CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCAACGGGGCCTTCGCGCACAGCGGCCCTGTCATCCCCGTCTACACCAGCAACAGCGGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGGAGGCCGTGGCGGAACTAAGGCCTCATGGGCCCAGCTTTCTTGTACAAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTACCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTCGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTAGTCGGCAAATAACCCTCGAGCCACCCATGACCAAAATCCCTTAACGTGAGTTACGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT

Sequencing Information:

Phred Score: 781
Date: 2016-06-16

Last Passing Sequencing Read:

NCGCATAGATTATTTTGACTGAAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGCCAGCTGATATAATGGAGAAAAATTCCTCGTCCCCGGTGGCTGCTACCCCAGCCAGTGTCAACACGACACCGGATAAACCAAAGACAGCATCTGAGCACAGAAAGTCATCAAAGCCTATTATGGAGAAAAGACGAAGAGCAAGAATAAATGAAAGTCTGAGCCAGCTGAAAACACTGATTTTGGATGCTCTGAAGAAAGATAGCTCGCGGCATTCCAAGCTGGAGAAGGCGGACATTCTGGAAATGACAGTGAAGCACCTCCGGAACCTGCAGCGGGCGCAGATGACGGCTGCGCTGAGCACAGACCCAAGTGTGCTGGGGAAGTACCGAGCCGGCTTCAGCGAGTGCATGAACGAGGTGACCCGCTTCCTGTCCACGTGCGAGGGCGTTAATACCGAGGTGCGCACTCGGCTGCTCGGCCACCTGGCCAACTGCATGACCCAGATCAATGCCATGACCTACCCCGGGCAGCCGCACCCCGCCTTGCAGGCGCCGCCACCGCCCCCACCGGGACCCGGCGGCCCCCAGCACGCGCCGTTCGCGCCGCCGCCGCCACTCGTGCCCATCCCCGGGGGCGCGGCGCCCCCTCCCGGCGGCGCCCCCTGCAAGCTGGGCAGCCAGGCTGGAGAGGCGGCTAAGGTGTTTGGAGGCTTCCAGGTGGTACCGGCTCCCGATGGCCAGTTTGCTTTCCTCATTCCCCACGGGGCCTTCGCGCACAGCGGCCCTGTCATCTCCGTCTACACCAGCCAACAGCGCACCTCCGTGGGCCCCAACGCAGTGTCACCTTCCAGCGGCCCCTCGCTTACGGCGGACTCCATGTGAAGGCCGTGGCCGAACTTAAGGCCTCATGGGCCCCACTTTCCTGTACAAAGTTGGCTTTATAAAAAATATTTGCTCATCATTTGGTTGCAACCAACAGGTCCCTATCAATTCAAATAAATTCATTATTTGCCTTCCAGCTTAATCCCCCAATAGGGAGTCGAATAAATGGGCATACCTGTTTCCCGGCAGCTCTGGGCCGGGTTTCAAAATCTTTAATTTACCTTGCAAAAATAAAAAATTTTCTTTTGCCTCCTTTAACAAGCCGAAAGAAATGCCCTATTTTCCTCCTCCCAGGTTTGCCGGGGACCTCCCCCTGGAAAGAATAAGGCCAACCCCGGTAATAAACCGTCTGGTTTAACCTTTTTCAATAGGGTATCCCCCACATCGGGCAACATTTACATACACCGGGTAAACGCGAGGCGTTTTGTGTGTTAATCTTTTTGGGAGATTATTCCGGAACAACAAAGCCTACCCGGTCTTTTTATGTAAACACCATCCCCGGGCCCCCAAATA

Vector Information:

Vector Name:pENTR223
Type:bacterial plasmid
Description:Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Properties:recombinational cloning
Comments:Additional information about this vector is available from the commercial website and at the ORFeome website http://www.orfeomecollaboration.org/html/vectors.shtml; also see supplemental figure 1 of the paper PubMed ID 15489335.
Map:pDONR223.1.gif
Sequence:pENTR223-seq.doc
Size (bp):2815
Form:dsDNA

Host Information:

Host Strain Is Used In Distribution Description
Mach1 T1-R Y E. coli Mach1 bacterial host strain with T1 phage resistance

Antibiotic Selections:

Host Type Marker
bacterial spectinomycin

Recommended Growth Condition:

Host Type Selection Condition Growth Condition Comments
bacterial 100 ug/mL spectinomycin Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.

Authors:

Author Name Author Type
The ORFeome Collaboration Consortium
MGC Consortium

Publications:

PMID Title
12477932 Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.